ID: 932774936

View in Genome Browser
Species Human (GRCh38)
Location 2:74522708-74522730
Sequence CTGGCAGCCCTGGATGATGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 270}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932774936_932774943 22 Left 932774936 2:74522708-74522730 CCATCATCATCCAGGGCTGCCAG 0: 1
1: 0
2: 3
3: 27
4: 270
Right 932774943 2:74522753-74522775 TGCATCAGTGCTTCTGGAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 211
932774936_932774942 16 Left 932774936 2:74522708-74522730 CCATCATCATCCAGGGCTGCCAG 0: 1
1: 0
2: 3
3: 27
4: 270
Right 932774942 2:74522747-74522769 AGGGCTTGCATCAGTGCTTCTGG 0: 1
1: 0
2: 3
3: 27
4: 169
932774936_932774940 -3 Left 932774936 2:74522708-74522730 CCATCATCATCCAGGGCTGCCAG 0: 1
1: 0
2: 3
3: 27
4: 270
Right 932774940 2:74522728-74522750 CAGATAGTCTAAATCTTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 113
932774936_932774944 27 Left 932774936 2:74522708-74522730 CCATCATCATCCAGGGCTGCCAG 0: 1
1: 0
2: 3
3: 27
4: 270
Right 932774944 2:74522758-74522780 CAGTGCTTCTGGAGCTGGTGAGG 0: 1
1: 0
2: 2
3: 29
4: 330
932774936_932774939 -4 Left 932774936 2:74522708-74522730 CCATCATCATCCAGGGCTGCCAG 0: 1
1: 0
2: 3
3: 27
4: 270
Right 932774939 2:74522727-74522749 CCAGATAGTCTAAATCTTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932774936 Original CRISPR CTGGCAGCCCTGGATGATGA TGG (reversed) Exonic
900411885 1:2516261-2516283 CCGGCAGCCATGGAGGAAGAAGG - Intronic
900478810 1:2888478-2888500 CAAGCAGCCCTGGAGGGTGAAGG - Intergenic
900556170 1:3281939-3281961 CCCGCAGCCCTGGATGTGGAGGG + Intronic
900718085 1:4157895-4157917 CTGGGACCCCTGGATAAGGAAGG + Intergenic
900865611 1:5266665-5266687 CTGGCATCCCTGCTTGATGGTGG + Intergenic
901642452 1:10699497-10699519 CTGGCAGCCCTGGCAGATCCAGG + Intronic
901957266 1:12795629-12795651 CTGACAGCCCTCCAAGATGAGGG - Exonic
901973665 1:12927886-12927908 CTGACAGCCCTCGAAGATGAGGG - Intronic
901980676 1:13031763-13031785 CTGACAGCCCTCCAAGATGAGGG - Exonic
901988757 1:13095519-13095541 CTGACAGCCCTCCAAGATGAGGG + Intergenic
901993056 1:13131248-13131270 CTGACAGCCCTCCAAGATGAGGG - Intergenic
902001413 1:13197168-13197190 CTGACAGCCCTCCAAGATGAGGG + Exonic
902011513 1:13273881-13273903 CTGACAGCCCTCGAAGATGAGGG + Intergenic
902020649 1:13342873-13342895 CTGACAGCCCTCCAAGATGAGGG + Exonic
902334001 1:15744485-15744507 CAGGAAGTCCTGGTTGATGAGGG - Exonic
902557987 1:17258296-17258318 CTGGCTGCCCTGGACAATGTTGG + Intronic
903036020 1:20493109-20493131 CTGGCAGGGCTGGATGGGGAGGG - Intergenic
903170290 1:21548218-21548240 GTGGCAGCCCTGGAAGCGGAGGG - Intronic
903650125 1:24917026-24917048 CTGGGACCCCTGGATGAGCATGG - Intronic
903971070 1:27119235-27119257 CTGGCAACCCAGGGTGATGTCGG - Intronic
908792594 1:67797908-67797930 CTGGCACCACTGGATGACCACGG + Intronic
909320826 1:74283584-74283606 CTTGCTGCCCTGGAAAATGATGG + Intronic
910494225 1:87808545-87808567 ATGCAAGCCCTGGATCATGAAGG + Intergenic
911422114 1:97656194-97656216 CTGGCAGCCCAGCAAGAAGAAGG + Intronic
913252801 1:116926016-116926038 CTAGAAGCCATGGGTGATGAGGG - Intronic
914335390 1:146710433-146710455 ATAGGAGGCCTGGATGATGAAGG - Intergenic
915690189 1:157681052-157681074 CTGGAAGGCCTGGACGAGGAAGG + Exonic
916797309 1:168179076-168179098 CTGGAAGCCGTGGATCATCATGG - Exonic
920173246 1:204084467-204084489 CTGGCAGCCCTGGAGGCTGCTGG - Intronic
920367028 1:205453566-205453588 CTGGCAGCCCTGGGTTCTTAGGG + Intronic
923124126 1:231020748-231020770 GAGGAAGCCCTGGAAGATGAAGG + Intronic
923242262 1:232097368-232097390 CTGGCTGCCCTGGGGGAGGAAGG + Intergenic
924063494 1:240200466-240200488 CTGATAGCCCTGGATAAGGAAGG + Intronic
1062961888 10:1578570-1578592 CTGGCAGCCGTGGGTGCTGTCGG + Intronic
1063001110 10:1923959-1923981 CTGGTGGGCCTGGATGATGGAGG - Intergenic
1066267285 10:33788648-33788670 CTGGCCACCCTGGATCATGGTGG - Intergenic
1067427214 10:46219482-46219504 CTGGTTCCCCTGGATGAGGACGG + Intergenic
1067582643 10:47455365-47455387 CTGGTTTCCCTGGATGAGGACGG + Intergenic
1067735640 10:48848187-48848209 CTGGCTGCCCTTGAGGAAGAAGG - Intronic
1069800131 10:71076834-71076856 TTGGCAGCCTGGGATGAGGAGGG + Intergenic
1071304837 10:84290044-84290066 CTGTCAGCCCTGAAGGATGAAGG + Intergenic
1072095925 10:92179748-92179770 CTGGCAGTGCTTGATGATGCAGG - Intronic
1072662934 10:97373579-97373601 CTGGCAGCCCTTGGTGATGAGGG + Exonic
1073537021 10:104286706-104286728 CTGTCAGAATTGGATGATGAAGG - Intronic
1074103964 10:110375173-110375195 GGGGCAGACCTGGATGAGGAAGG + Intergenic
1074853620 10:117457610-117457632 CTGGCAGCTCTGGGTGGAGAAGG + Intergenic
1075385629 10:122053444-122053466 ATGGCTGCCCTGGGTGATAATGG - Intronic
1075490719 10:122866497-122866519 CTGGCAACCCTGTATTAAGAAGG + Intronic
1075879864 10:125841871-125841893 CTGGCAGCACTGGATAATGATGG - Exonic
1076721417 10:132395065-132395087 CTGGCAGCTCTGGCTGGAGAGGG - Intergenic
1077457902 11:2691994-2692016 CTGGAAGCCCTTGGTGCTGAGGG - Intronic
1078638578 11:13075142-13075164 CTGCCAGCACTGGATCCTGAGGG - Intergenic
1080688831 11:34538456-34538478 CTGACAGCCCTGGAAGATAATGG - Intergenic
1081670481 11:44939540-44939562 CTGGCAGCCCTGGCTGGGGCAGG - Intronic
1081694864 11:45102722-45102744 CTGGCCGCCCTGGTGGATGCTGG + Intronic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1082997077 11:59263136-59263158 CTGCCAGCCCTGGCCCATGATGG + Intergenic
1083962664 11:66022967-66022989 CCGGAAGCCCTGAATGAGGAAGG + Exonic
1084121277 11:67070462-67070484 CTTGCAGCCCACGACGATGATGG - Exonic
1084380636 11:68810322-68810344 CTGGCAGACCTGGGTGCTCAGGG - Intronic
1084430692 11:69109296-69109318 AGGGCAGGCCTGGCTGATGAAGG + Intergenic
1084730117 11:71067383-71067405 TTTTCTGCCCTGGATGATGAAGG - Intronic
1085234839 11:75006322-75006344 CTGGCTGCTCTGGAGGAGGAGGG + Exonic
1085721201 11:78913866-78913888 CTGGCTTCCTTGGATGGTGAAGG + Intronic
1087419890 11:97908606-97908628 CCAGCAGCTCTGGATGTTGAAGG - Intergenic
1088723641 11:112616091-112616113 CTGAAAGACCAGGATGATGAAGG - Intergenic
1089569028 11:119390183-119390205 CTGACATCCCAAGATGATGAAGG - Intergenic
1090095151 11:123735462-123735484 TTGGCAGCCTAGGAAGATGAAGG + Intronic
1090404646 11:126469431-126469453 CTTGCAGCCCTGGGGGAGGAGGG + Intronic
1091405741 12:208204-208226 ATGGTGGCCCTGGATGAAGAAGG + Intronic
1092651752 12:10642206-10642228 ATGGCAGCCCTGGAATCTGATGG + Intronic
1092901414 12:13062913-13062935 CTGCCAGACTTGGATGAAGACGG + Exonic
1094783336 12:33818252-33818274 CTGGCAGCAGTGGGTGGTGAGGG + Intergenic
1096688283 12:53303552-53303574 CTGGCTGCCCTGAAGGTTGAGGG + Intronic
1101604583 12:106238506-106238528 CTGTCAGCTCTGAATGAGGAGGG - Exonic
1102070187 12:110012488-110012510 ATGGGAGCCCAGGATGATGCAGG + Intronic
1102174178 12:110864057-110864079 ATGCCAGCCATGGCTGATGAGGG - Intronic
1103170446 12:118814141-118814163 CTGGCAGCACAGGACGCTGAGGG - Intergenic
1104640149 12:130462003-130462025 CTGTCAGCCCAGGCTGCTGATGG - Intronic
1104663710 12:130632517-130632539 CCGGCAGCCCAGGAAGATGAGGG - Intronic
1105202223 13:18190556-18190578 CTGGGACACCTGGATGATGAAGG - Intergenic
1105971717 13:25434930-25434952 GTCTCATCCCTGGATGATGATGG + Intronic
1110689310 13:78413208-78413230 CTGGCCTCCCTGGAGGTTGAAGG + Intergenic
1110862126 13:80355654-80355676 CTGCCAGCCCTGGGCAATGAGGG + Intergenic
1111320670 13:86624335-86624357 CTGGCAGCCCAGGGTTAGGATGG + Intergenic
1113075965 13:106468361-106468383 CTGAGAGCCTTGGGTGATGAGGG + Intergenic
1113909027 13:113833196-113833218 CTGACACCCCTGGAAGATGGAGG + Intronic
1117302502 14:54443159-54443181 CTGCCGGCCCCGGGTGATGAGGG + Intergenic
1119422691 14:74516971-74516993 CAGCCAGCCCTGGAGGATGGTGG + Intronic
1121277742 14:92679280-92679302 CTGGCAGCCCTGTCTGACCACGG + Intronic
1121404926 14:93713935-93713957 CTGGGAGCCCTGGAAGATGGTGG + Intergenic
1122131518 14:99606582-99606604 CTGCCAGCTCTGGAGGATCAGGG - Intergenic
1125175929 15:36821726-36821748 CTCCCAGCCCTAGAAGATGAGGG - Intergenic
1125919664 15:43517990-43518012 CTGACAGCCCAGGATGCTGGAGG + Intronic
1126111813 15:45179666-45179688 CTGGCAGCCCTGGGTGAACCGGG - Intronic
1127850880 15:62910676-62910698 GCGGCTGCCTTGGATGATGAAGG + Intergenic
1127867331 15:63043051-63043073 CTGGCCGCCCTGGGTGGTGGTGG - Intronic
1128512549 15:68322283-68322305 CTGACAGACCTGCATGCTGAAGG + Intronic
1128818364 15:70630378-70630400 CTGGCAGCCCAGGACAATGGAGG + Intergenic
1129165146 15:73772836-73772858 GTGTCAGCCCAGGCTGATGAAGG - Intergenic
1129272717 15:74427937-74427959 CTGGCTGCCCTCCATGATGAGGG + Intronic
1129672027 15:77612849-77612871 CTGGCAGCACTGGCTGGAGAAGG - Intergenic
1129789825 15:78333361-78333383 CTGGAAGGCCTCGAGGATGAGGG - Intergenic
1130146956 15:81281656-81281678 ATGGAAGCCCAGGATTATGAGGG - Intronic
1130660917 15:85830926-85830948 CCAGCAGCCCTGCATGATAAGGG - Intergenic
1131211405 15:90500120-90500142 CTGCCAGCCCAGAAGGATGAAGG + Exonic
1132543093 16:520511-520533 CTTGGCGCCCTGGATGCTGAGGG - Exonic
1132937160 16:2486977-2486999 CTGGTGGCCCTGGAGGAGGAAGG - Intronic
1133418957 16:5629378-5629400 CTGGCAGTCCTGGTTGACCACGG - Intergenic
1133765194 16:8832885-8832907 CTGCCAGGCCTGGAGGGTGAGGG - Intronic
1133833110 16:9342443-9342465 CTGGCAGCCCTGAAAGCTGAGGG - Intergenic
1134027731 16:10967217-10967239 CTGGGAGCCCGGGATCGTGATGG - Intronic
1134249832 16:12566466-12566488 CTGGCTGTGCTGAATGATGATGG + Intronic
1134619687 16:15678146-15678168 CTGGCAGCCCAGGGTGCTGTGGG + Intronic
1136022481 16:27448964-27448986 CTGGCAGCCCTGGGCTAGGAGGG + Exonic
1136108959 16:28052757-28052779 CAGGCTGCCCTGGCTGAGGAGGG + Intronic
1139293184 16:65876235-65876257 CTGGCATCCCTCCATGGTGATGG - Intergenic
1139998233 16:71000795-71000817 ATAGGAGGCCTGGATGATGAAGG + Intronic
1140934312 16:79656527-79656549 CTGAAAGCCCTGGGTGGTGATGG + Intergenic
1141380825 16:83575134-83575156 CCGGCAGCCATGGAAAATGAAGG + Intronic
1141943454 16:87293961-87293983 CGGGCAGCCCTGGCTTACGATGG + Intronic
1145303544 17:21656866-21656888 CTGGAAGCCCTGGTTGCTGCCGG + Intergenic
1145802077 17:27694068-27694090 CTGGCATCCCTGTGTGAAGAAGG + Intergenic
1146647255 17:34583475-34583497 CAGGCAGCCCTGGAGGAGGAGGG - Intronic
1146793426 17:35765563-35765585 CAGGCAGCCCTGCAGGCTGAGGG - Intronic
1147860608 17:43520220-43520242 CTGGGGGCCCTGGATGACGAGGG + Exonic
1147965251 17:44191214-44191236 CAGGCAGCCCTGGGTGCTGGGGG - Exonic
1148131047 17:45262735-45262757 CCGGCATCCCTGGATGGTCAGGG + Intergenic
1148158750 17:45437930-45437952 CTGGCAGCTCTGGTGGAAGACGG + Exonic
1148748408 17:49931144-49931166 GTGCCAGCCCAGGATGATGATGG - Intergenic
1148771766 17:50071496-50071518 CTGGCAGACCTGAACAATGATGG + Exonic
1149334895 17:55625668-55625690 CTAGCAGCCCTGGCTGCTGTGGG + Intergenic
1150285547 17:63951827-63951849 CTGGCAGCCTCGGATGAGGATGG - Exonic
1150390161 17:64785328-64785350 CTGGCAGCTCTGGTGGAAGACGG + Intergenic
1151380975 17:73725610-73725632 TTCACAGCCCTGGATGGTGAAGG - Intergenic
1152225536 17:79091024-79091046 CACTCAGCCCTGGAAGATGAGGG - Intronic
1152723609 17:81934711-81934733 CTGGATGCCCTGGCTGATGGGGG - Exonic
1156395051 18:36691737-36691759 CCTGCAGCCCAGGATGCTGAGGG - Intronic
1159629430 18:70732372-70732394 TTGGCAGCCCAGGATGAGGATGG + Intergenic
1159921615 18:74231898-74231920 CTGGTTGCCCTGGAGGATGCAGG - Intergenic
1160355108 18:78221179-78221201 CTGGCACCTGTGGATGAGGAGGG + Intergenic
1160532086 18:79571533-79571555 CTGGCATCCCTGCCTGGTGAGGG - Intergenic
1160683711 19:423834-423856 CAGGCAGCCCCGGTTGAGGAAGG - Intronic
1161302810 19:3551229-3551251 CTGGGAGCCCTGGCTGGTGCGGG - Intronic
1161593118 19:5137588-5137610 CAGACAGCCCTGGATGAGCAGGG - Intronic
1163416987 19:17192882-17192904 CCAGCAGGCCTGGATGGTGACGG - Exonic
1165473421 19:36016175-36016197 CTGGTTCCCCTGGATGCTGAGGG - Exonic
1166560250 19:43728061-43728083 CTGGCACCTGTGGATGATGGTGG + Exonic
1166644447 19:44520559-44520581 CTGGAGGCCATGGATGATTAGGG + Exonic
1166959945 19:46491386-46491408 CTGGCAGCCATGTATGGTGGGGG + Exonic
1168564585 19:57412360-57412382 CAGGCAGGCCTGGTTGCTGATGG + Intronic
925458906 2:4043190-4043212 CTGGCAGCCCTTGGTGTTCAAGG - Intergenic
926091607 2:10054605-10054627 CTGGCGGCTCTGGGTGCTGACGG + Exonic
929094654 2:38251885-38251907 CTGACATTCCTGGAAGATGATGG - Intergenic
929890881 2:45917923-45917945 CTGCCAGCCCTGGGCAATGAGGG - Intronic
929893739 2:45939935-45939957 CTGCCAGCCCAGTATGGTGAGGG - Intronic
932494589 2:72140101-72140123 CTCCCAGCCTTGGAAGATGAAGG - Intronic
932774936 2:74522708-74522730 CTGGCAGCCCTGGATGATGATGG - Exonic
936444458 2:112585132-112585154 CTGGAAGCCCTGGATGAGGTTGG - Intronic
937876268 2:126827687-126827709 CCCGCAGCCCTGGAGGAAGAAGG + Intergenic
937924594 2:127158017-127158039 CTGGCACCTCTGGATGCTGTTGG - Intergenic
939159396 2:138568308-138568330 CTTGCATCACTGGATGATGGTGG + Intronic
939748171 2:146004106-146004128 CTGGCAGGCCTGGATTTTGGGGG + Intergenic
941210049 2:162626275-162626297 CTGGCATATTTGGATGATGAAGG + Intronic
942641605 2:178066726-178066748 CTGCCAGCTCTGGGTGAGGAGGG - Intronic
944668087 2:201973124-201973146 CTGGCTGCCCTGAATGCTGACGG - Intergenic
946139636 2:217678729-217678751 ATGGCAACCTTGGATGATCAGGG - Intronic
946374126 2:219297916-219297938 CTGGCAGCCCTGGGGCCTGAGGG - Exonic
946849544 2:223891783-223891805 CTGTATTCCCTGGATGATGAGGG - Intronic
947543723 2:230995981-230996003 CTGGCAGCCTGGGATGAAGGAGG + Intergenic
948601046 2:239107677-239107699 CTGGCAGCCCTGGGGGAGCATGG + Intronic
1169110642 20:3031050-3031072 CTGTCTGCCCAGGCTGATGATGG - Intronic
1169194745 20:3677100-3677122 CTGGTGGCCCTGGAGGCTGAAGG - Exonic
1173253067 20:41374799-41374821 CTGGCAGTCCTGGATGCGGGGGG + Intergenic
1174280333 20:49434524-49434546 CAGGGAGCCCAGGAAGATGATGG - Intronic
1175417707 20:58812533-58812555 CTTGGAGGCATGGATGATGATGG + Intergenic
1175894691 20:62330881-62330903 CTGGCAGTCCCTGAGGATGATGG + Exonic
1176093167 20:63327939-63327961 CTGGCAGTCCCTGATGAGGAGGG - Exonic
1176198471 20:63848548-63848570 CTCACTGCCCTGGAAGATGAGGG + Intergenic
1176715723 21:10347452-10347474 CTGGGACACCTGGATGATGAAGG + Intergenic
1179633164 21:42691128-42691150 CTGGTGACTCTGGATGATGATGG - Intronic
1179802979 21:43820188-43820210 CTGGCAGCCCTGAATGATACGGG + Intergenic
1180602617 22:17032501-17032523 CTGGGACACCTGGATGATGAAGG - Intergenic
1180735379 22:18012557-18012579 CTGGCAGCCCTGGGAGCTGAGGG - Intronic
1181008835 22:20028503-20028525 CTGGCAGCTCTGGAGGCTGGTGG - Intronic
1181531069 22:23517808-23517830 CTGGCGGCCTTGGCTGAGGAAGG + Intergenic
1181556301 22:23673545-23673567 CTGGCAGCCCTGAATGGGGGCGG - Intergenic
1182257323 22:29048611-29048633 CTGGCAGCCCTGGGTTTTGGAGG + Intronic
1182427083 22:30279579-30279601 CTGCCAGCCCTGGGTCAGGAAGG + Intergenic
1183082803 22:35467731-35467753 CTGGCATCCAGGGATGCTGAGGG - Intergenic
1183786208 22:40030507-40030529 CTGGAAGCCCTGGTTGGTGAAGG - Exonic
1185108793 22:48889374-48889396 CTGCCAGGCCTGGATGAGGGAGG - Intergenic
1185173875 22:49308185-49308207 AGGACAGCCCTGGATGCTGAGGG + Intergenic
1185346181 22:50311837-50311859 CTGGGAGCCCTTGCTGATGTGGG - Exonic
950600387 3:14029747-14029769 CTGACAGCCCTGGGCAATGAGGG - Intronic
952287205 3:31980904-31980926 CTGCCAGCCCTGGAGGAGGTTGG + Exonic
952708525 3:36405504-36405526 GCGACAGCCCTAGATGATGAAGG - Intronic
953000751 3:38931060-38931082 CTGGAAGCCTTTGATGAGGAGGG - Intronic
953388934 3:42523357-42523379 CTGGCTGCCATAGATGGTGAAGG - Intronic
953958247 3:47247608-47247630 CTGGCAGGACCCGATGATGAAGG - Intronic
955003543 3:54949065-54949087 CTGGGGGCACTGGATGAGGAAGG - Intronic
956750776 3:72342242-72342264 CTGGCAGCTCTGCCTGAGGAGGG - Intergenic
958843530 3:99237999-99238021 GCAGTAGCCCTGGATGATGATGG + Intergenic
958879923 3:99658197-99658219 CGGGCAGGCCCAGATGATGAAGG - Intronic
960154980 3:114290588-114290610 TTGGCAGCCTTGGAGGATGGAGG + Intronic
960747709 3:120908289-120908311 CTGCCAGCCCGGGAAGCTGAGGG - Exonic
961348231 3:126278663-126278685 CAGACAGCCCTGGATGGTGCGGG + Intergenic
961688792 3:128653507-128653529 CTGCCAGCCCTGGGCAATGAGGG + Intronic
962160664 3:132996411-132996433 ATGGCAGCCCTGGATGGTCTAGG + Intergenic
966735421 3:183182960-183182982 CTGGAAGGCCTGGGTGAGGAAGG - Intronic
966818522 3:183907880-183907902 CCGGCTGCCTTGGATGTTGATGG + Intergenic
969321703 4:6416780-6416802 CTGGCAGGGCTGGAGGAGGAGGG + Intronic
970180170 4:13383837-13383859 CTGTCAGACCTGAATGATGCAGG + Intronic
971140039 4:23915003-23915025 CTGGGAGCCATGAATGTTGATGG - Intergenic
973587770 4:52409998-52410020 CTGCCAGCCCTGGGCAATGAGGG - Intergenic
977668155 4:99664932-99664954 CCAGCAGCCATGGGTGATGAAGG + Intergenic
982162962 4:152588206-152588228 CTGGCAGCCCTTGCTGGGGATGG + Intergenic
985420461 4:189780345-189780367 CTCCCAGCCATGGCTGATGAAGG + Intergenic
985504106 5:268833-268855 CTGGGTGCCATGGGTGATGATGG + Intergenic
985820842 5:2159224-2159246 CTGGAAGCCCTGGTTGGTGCTGG + Intergenic
985839442 5:2295201-2295223 CTCCCAGCCCTGGATGTTCAAGG - Intergenic
986066023 5:4234961-4234983 CATGCATCCCTGGATGATGCAGG + Intergenic
986415810 5:7526825-7526847 CTGGAATCCCTTAATGATGAAGG + Intronic
990501582 5:56401737-56401759 CTGACAGCCATGGTTGATGGGGG + Intergenic
992340567 5:75818944-75818966 TTGGCAGCCCCGAATGATCAGGG - Intergenic
993045670 5:82863454-82863476 TTGTCTGCCCTGGATGCTGAAGG + Intergenic
995356763 5:111246631-111246653 CTTACTGTCCTGGATGATGATGG - Intronic
997641745 5:135452923-135452945 CTGGCTGCCCTGGAATGTGAAGG + Intergenic
997804825 5:136906589-136906611 CAGGCAGCCCTGGCAGAAGATGG - Intergenic
997910754 5:137870767-137870789 CTGGCGGGGCTGGATGATAATGG - Exonic
998624897 5:143835306-143835328 GTGTCAGCTCTGGATGATGTTGG + Intergenic
998867643 5:146521378-146521400 CTGGGAGCCCAGGATCATAAAGG + Intergenic
1001090949 5:168740583-168740605 CTGGCAGACCTGGAGAATTATGG - Intronic
1001985602 5:176072636-176072658 CTGGCTGGCCTCGATGAGGACGG - Intronic
1001985981 5:176074753-176074775 CTGGCTGGCCTTGATGAGGACGG - Intronic
1002051726 5:176575305-176575327 CAGGGAGCACTGGATGGTGAAGG - Exonic
1002063764 5:176642132-176642154 CTGCCTGACCTGGATGGTGAGGG - Exonic
1002230889 5:177763371-177763393 CTGGCTGGCCTTGATGAGGACGG + Intronic
1002231270 5:177765488-177765510 CTGGCTGGCCTCGATGAGGACGG + Intronic
1002264068 5:178018260-178018282 CTGGCTGGCCTCGATGAGGACGG - Intronic
1002264448 5:178020377-178020399 CTGGCTGGCCTTGATGAGGACGG - Intronic
1003327289 6:5101549-5101571 GTGGCAGGGCTGGAAGATGAAGG + Intergenic
1005997061 6:30938055-30938077 CTGGCAGGCCTGTGAGATGAGGG - Intergenic
1005997700 6:30941350-30941372 CTGCCAGCCCTGGATGGTGGGGG + Intronic
1006609850 6:35287777-35287799 CTGGCAGCAGAGGATGATGAGGG + Exonic
1007095312 6:39209311-39209333 CTGGCATACCTGGATGGTGAGGG - Intronic
1007628974 6:43262299-43262321 CAGGCAGGCCTGGAGGGTGATGG + Intronic
1008270500 6:49483668-49483690 CTGCCAGCCCTGGGCAATGAGGG - Intronic
1008911694 6:56740437-56740459 CTGACTGCCCTGGATGAGGTTGG - Intronic
1011383968 6:86773630-86773652 TTTGCAGCCCTGGAAGAAGAAGG + Intergenic
1014155281 6:118102543-118102565 GTGACAGCCCTGGATGACAAGGG + Intronic
1014898422 6:126932473-126932495 CAGGCAGCTCTCGATGAAGAAGG - Intergenic
1019993485 7:4708362-4708384 CCAGCAGCCCTGGATGAAGGAGG - Intronic
1022268172 7:28779478-28779500 TTGGCAGGCCTGGATGAGGGAGG - Intronic
1023584894 7:41718983-41719005 CTGGGAGACATGGATGAGGATGG - Intergenic
1026369497 7:69684358-69684380 CTTGCTGCCCTGGTTCATGAGGG + Intronic
1026373246 7:69723144-69723166 CTGGCTGCTGTGAATGATGAAGG - Intronic
1027125408 7:75553520-75553542 CTGGCCTCCCTGGAGGAAGAGGG - Exonic
1030216489 7:107048322-107048344 CTTGAAGCCCAGGATGATCAGGG + Intronic
1030290824 7:107871086-107871108 CTGGCAGCCCTGGCAGCTGGAGG - Intergenic
1032478665 7:132229319-132229341 CTTGCAGTCCTAGCTGATGAAGG + Intronic
1032485812 7:132286662-132286684 CTAGAAGTCCTGGAAGATGAGGG + Intronic
1034286134 7:149884253-149884275 CTTGTAGCACTGGAAGATGAGGG + Intergenic
1034521659 7:151625306-151625328 CTGGCAGGCCTGGAGGAGCAAGG + Intronic
1035414732 7:158673435-158673457 CTGGCTGCCCGGGAAGAAGAAGG - Intronic
1038493212 8:27984369-27984391 CTGGCAGCCAGGAATGAAGATGG + Intronic
1038751304 8:30298544-30298566 CTTGCAACCCTTGATGATGATGG + Intergenic
1038850918 8:31275575-31275597 CTGGGAGCCCTGCATGATGAAGG + Intergenic
1041208551 8:55523386-55523408 CCAGCAGAACTGGATGATGACGG - Exonic
1041914519 8:63126218-63126240 CTGCCAGCCCTGGGCAATGAGGG + Intergenic
1044601674 8:94011583-94011605 CTGGCAGCATTGTATGATGCAGG + Intergenic
1049191522 8:141290657-141290679 TTGGCAGCCCTGGAGGAGGGCGG - Intronic
1049288681 8:141790473-141790495 CTGGCAGCCCTGCATGAGTGTGG - Intergenic
1049357695 8:142196829-142196851 TTGGGAGCTCTGGATGCTGAAGG + Intergenic
1049381840 8:142320067-142320089 GTGGCAGCCCAGGGTGAGGAGGG - Intronic
1049488767 8:142879998-142880020 CTCTCAGCCCTGGAGGAGGAGGG - Intronic
1049542861 8:143216215-143216237 CTTGCAGCCTTGGATGGGGAAGG + Intergenic
1049590997 8:143462529-143462551 CTTGCAAGCCTGGAGGATGAAGG + Intronic
1054722439 9:68617132-68617154 CTGCCAGCCCTGGGCAATGAGGG + Intergenic
1055686347 9:78779180-78779202 TGGGCAGCTCTGAATGATGAAGG + Intergenic
1056574968 9:87849163-87849185 CTGGCTGCTCTGGTTGATGTTGG - Intergenic
1057459719 9:95250174-95250196 CTGGCTTCCATGGGTGATGAAGG - Intronic
1057604377 9:96488709-96488731 CAGGCAGCCTTGGCTGAGGACGG - Intronic
1060555421 9:124505119-124505141 CTGGGGGGCCTGGAGGATGAGGG - Intronic
1060777208 9:126383761-126383783 GTGGCAGCCCTGTGTGAGGAGGG + Intronic
1061375182 9:130219874-130219896 CTGGCACCCCTGCCTGGTGAGGG - Intronic
1061870306 9:133516841-133516863 ATGGCAGCCCGGGAGGAAGAAGG - Intronic
1062035482 9:134380801-134380823 CGGGCAGCCCTGGATTCTGGAGG - Intronic
1062231375 9:135483742-135483764 CTGGCAGCGCAGGATGAGAAGGG + Intronic
1062234819 9:135502709-135502731 CTGCCAGCCCCCGATGCTGATGG - Intronic
1062506019 9:136876944-136876966 CTGGCTGTGCTGGCTGATGAGGG + Intronic
1203782778 EBV:110087-110109 CTACCAGACCTGGAAGATGAGGG + Intergenic
1185783859 X:2872889-2872911 CTACCAGCCCTGGTTGAAGAAGG + Intronic
1186414263 X:9369800-9369822 CTGTCATCCCTGGAGGAGGAGGG + Intergenic
1186509700 X:10121430-10121452 CTTCCAGCCCTGGCTGATGGGGG + Intronic
1188751904 X:33914450-33914472 CTGGCGGCTCTGGTTGCTGATGG - Intergenic
1189170877 X:38908235-38908257 CTGGCACCACTGGAGTATGAAGG - Intergenic
1192432903 X:71124757-71124779 CTGAGAGCCCTGGATCCTGAGGG - Exonic
1198055042 X:132985461-132985483 GTGGCAGAGCTGGATGTTGAAGG - Intergenic
1199853861 X:151743998-151744020 CTGGCAGTGGTGGCTGATGATGG + Exonic
1200148450 X:153939683-153939705 CTGGCAGCCCGGGAGGATAAAGG - Intronic