ID: 932775841

View in Genome Browser
Species Human (GRCh38)
Location 2:74527931-74527953
Sequence TCCGTGTACAACAGGTGGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932775841_932775846 9 Left 932775841 2:74527931-74527953 CCCGACCACCTGTTGTACACGGA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91
932775841_932775847 20 Left 932775841 2:74527931-74527953 CCCGACCACCTGTTGTACACGGA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932775841 Original CRISPR TCCGTGTACAACAGGTGGTC GGG (reversed) Exonic
902659438 1:17890999-17891021 TTCGTGTCCAACAGGTGATGAGG - Intergenic
906043976 1:42813660-42813682 TCCGTGTACAACAAATGCTCTGG - Intronic
906518316 1:46452563-46452585 TCCGTGTCCCACAGGTGCTGGGG - Intergenic
910028028 1:82681717-82681739 TCCGTGTACAACAGGTCTTTTGG - Intergenic
1089011164 11:115132902-115132924 TCAGTGCAGAACAGGTGGTCTGG + Intergenic
1091996152 12:4995785-4995807 GCAGTGTACAGCAGGTGGTGAGG + Intergenic
1095726720 12:45461874-45461896 CCCGTGTGAAACAAGTGGTCTGG + Intergenic
1106144715 13:27040686-27040708 TCCGTGTAGGAGAGGTGGCCAGG + Intergenic
1117325981 14:54669302-54669324 TCCGTGGAAAGCAGGTGCTCAGG - Intronic
1120426905 14:84359864-84359886 TCAATGTAAAACAGGTGGCCGGG - Intergenic
1121926623 14:97932941-97932963 TTCTTGTACAACAGGTGCTTTGG + Intronic
1133311253 16:4847954-4847976 TCCGGGGACACCAGGGGGTCGGG - Intronic
1137669458 16:50270987-50271009 TCCGTGTGCAGCAGCAGGTCAGG - Intronic
1139493440 16:67299541-67299563 TCAGGGGAGAACAGGTGGTCGGG + Exonic
1143749348 17:9017057-9017079 TGCTTGTAAAACTGGTGGTCAGG - Intergenic
1157990155 18:52485628-52485650 TACGTGTACAACAGGTCTCCTGG - Intronic
1160360150 18:78268364-78268386 TCCCTGGACACCAGGTGGCCCGG + Intergenic
1160976672 19:1796247-1796269 GCCTGGTACAACAGCTGGTCTGG + Exonic
1161085831 19:2334474-2334496 CCCATGTTCACCAGGTGGTCTGG - Intronic
931092383 2:58899962-58899984 TCAGTCCACAACAGTTGGTCTGG - Intergenic
932775841 2:74527931-74527953 TCCGTGTACAACAGGTGGTCGGG - Exonic
948037069 2:234866205-234866227 TCCGTGGACAAGAGCTGGCCAGG + Intergenic
1179139826 21:38715110-38715132 TCAGTGTACATCACGTGGTTTGG + Intergenic
1180218945 21:46345799-46345821 TCCGTTTACATCAAGTGTTCAGG - Intronic
1184337107 22:43860357-43860379 TCTGGGCACAACAGGTGTTCAGG + Intronic
962315530 3:134357280-134357302 CCCGTGGACACCAGGTGGACTGG - Exonic
968539015 4:1153222-1153244 TCTGTGGACACCAGGAGGTCAGG + Intergenic
969042666 4:4312839-4312861 CTCGTGTACAGCAGGTGGCCAGG + Intronic
986238083 5:5930829-5930851 TCGCTTTAGAACAGGTGGTCAGG + Intergenic
991282326 5:64929338-64929360 TTTTTGTAGAACAGGTGGTCTGG - Intronic
1007017785 6:38486795-38486817 TCCGTGTTCAACAAGTGTTTTGG - Intronic
1032601453 7:133300502-133300524 TTCATGTACAAATGGTGGTCGGG - Intronic
1034072870 7:148203898-148203920 ACCGAGTCCAAGAGGTGGTCAGG - Intronic
1034998697 7:155594522-155594544 TCTGGGTACAGCAGCTGGTCTGG - Intergenic
1035729449 8:1844092-1844114 CCCATGTGCAACATGTGGTCCGG - Intronic
1044455478 8:92387999-92388021 TCAGTCTACAACAAGTGGCCAGG - Intergenic
1062075259 9:134585173-134585195 TCCGTGTACCCCAGGCGGTGAGG + Intergenic
1185820643 X:3200006-3200028 TCCTTGAACAACATGTGTTCAGG - Intergenic
1198746844 X:139899830-139899852 TTCTTGTACAACAGGTGTCCAGG - Intronic