ID: 932775842

View in Genome Browser
Species Human (GRCh38)
Location 2:74527932-74527954
Sequence CTCCGTGTACAACAGGTGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932775842_932775846 8 Left 932775842 2:74527932-74527954 CCGACCACCTGTTGTACACGGAG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91
932775842_932775847 19 Left 932775842 2:74527932-74527954 CCGACCACCTGTTGTACACGGAG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932775842 Original CRISPR CTCCGTGTACAACAGGTGGT CGG (reversed) Exonic
901779571 1:11584630-11584652 CTCCCTGAAAAAGAGGTGGTTGG + Intergenic
902797146 1:18807284-18807306 CTCTGTGTCCAGCAGGTGGAAGG - Intergenic
905115047 1:35631431-35631453 CTGAGTGTACAAAAGATGGTGGG - Intronic
906518317 1:46452564-46452586 CTCCGTGTCCCACAGGTGCTGGG - Intergenic
915735297 1:158080807-158080829 CTCCGTGTGCTGCAGGTGGCAGG - Intronic
919752791 1:201048674-201048696 CTCCCTGTACAGCGGCTGGTGGG - Exonic
1067711365 10:48653749-48653771 CCCCCTGTACACCAGGTCGTGGG - Intronic
1072329217 10:94330044-94330066 CTCAGTTTTCAACACGTGGTAGG - Exonic
1078526475 11:12105293-12105315 CTCCTTGTGCAGCAGGTAGTAGG - Intronic
1087761580 11:102109436-102109458 CTCCTTGTACATCAGGTGCCTGG + Intergenic
1102405392 12:112669149-112669171 CTCCGTTTACCACAGGAGGCAGG + Intronic
1120426906 14:84359865-84359887 CTCAATGTAAAACAGGTGGCCGG - Intergenic
1122262863 14:100533082-100533104 CTCCGAGTCCCACAGGTGGCAGG - Intergenic
1125448938 15:39787711-39787733 CTCCGTGTAGAACAGCTGCAGGG - Intergenic
1126705379 15:51400904-51400926 CTCTCTGTCCAACAGGTGGCTGG - Intronic
1127597159 15:60497174-60497196 CTCTGTTTACAACAGGAGGAGGG - Intronic
1133311254 16:4847955-4847977 CTCCGGGGACACCAGGGGGTCGG - Intronic
1139493439 16:67299540-67299562 CTCAGGGGAGAACAGGTGGTCGG + Exonic
1141592316 16:85077204-85077226 CTCAGTGCACAGCAGGTGCTGGG + Intronic
927560640 2:24070212-24070234 CTCAGTGTCCAATACGTGGTAGG - Intronic
928997787 2:37313261-37313283 CTCTATTGACAACAGGTGGTGGG + Intronic
932559519 2:72855054-72855076 CTCAGTGCACCACAGGTGGCAGG - Intergenic
932729240 2:74206468-74206490 CTCTGTGGACAAGAGGTGGGTGG + Intronic
932775842 2:74527932-74527954 CTCCGTGTACAACAGGTGGTCGG - Exonic
1174412097 20:50342946-50342968 CTCAGCTTACAACATGTGGTAGG + Intergenic
1175144385 20:56884786-56884808 CTCCGTGTTGAACAGGAGCTGGG - Intergenic
1176057827 20:63158183-63158205 CTTAGTGTTCAGCAGGTGGTTGG + Intergenic
954321146 3:49832799-49832821 CTCCTTGTATGACAGGAGGTGGG - Intronic
954933254 3:54302785-54302807 CTCCGTGTACAACCGGATGGAGG - Intronic
958161984 3:89829121-89829143 CTACCTATACAACAGGTGGATGG - Intergenic
965333121 3:167401818-167401840 CTCCGTCTAGAACAGGAGCTGGG - Intergenic
967869587 3:194218840-194218862 CTCCTTGTACATGATGTGGTGGG - Intergenic
974877520 4:67716818-67716840 CTCAGGGTACACCAGATGGTGGG + Intergenic
986293444 5:6418324-6418346 CTTCCTGTAAAACGGGTGGTGGG - Intergenic
986672253 5:10152678-10152700 CCCCATTTACCACAGGTGGTTGG + Intergenic
993941413 5:94063143-94063165 CTACATGTACCACAGGTGGTGGG + Intronic
996796074 5:127349784-127349806 CGCCATCTAGAACAGGTGGTAGG - Intronic
1002878293 6:1230409-1230431 CTCTGTGCCCAACAGCTGGTAGG + Intergenic
1008649276 6:53546647-53546669 CTCCGTGAAAAGCAGGTAGTGGG + Intronic
1017008797 6:150048278-150048300 ATCTGTCTACACCAGGTGGTGGG - Intergenic
1018545271 6:164928857-164928879 CCCTGTGTAAAACAGGAGGTAGG + Intergenic
1019215915 6:170443687-170443709 CTCTGTGTACAACGTGTGCTTGG + Intergenic
1019692419 7:2423727-2423749 CTCAGTGTACAGAGGGTGGTGGG - Intronic
1022028292 7:26468619-26468641 CTCCGTGTTTAAGAGGTGCTGGG - Intergenic
1024352449 7:48380866-48380888 CGCCCCGTACAGCAGGTGGTAGG - Intronic
1032601454 7:133300503-133300525 CTTCATGTACAAATGGTGGTCGG - Intronic
1038328184 8:26588160-26588182 CTCAGTGTACAAGAGATGGGAGG - Intronic
1048330016 8:133464882-133464904 CTCAGGGTACACCAGATGGTGGG + Exonic
1049030224 8:140030601-140030623 CTCCATGTCCAACAAGAGGTAGG + Intronic
1062478310 9:136740407-136740429 TTCCGTGTACCCCAAGTGGTTGG + Intronic
1191627009 X:63280518-63280540 CTCTGTGTACAAAAGATTGTTGG + Intergenic
1196123433 X:112074781-112074803 CTCAGTGTGCACCAGGTGGAAGG - Intronic