ID: 932775843

View in Genome Browser
Species Human (GRCh38)
Location 2:74527936-74527958
Sequence TGCACTCCGTGTACAACAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932775843_932775847 15 Left 932775843 2:74527936-74527958 CCACCTGTTGTACACGGAGTGCA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 27
932775843_932775846 4 Left 932775843 2:74527936-74527958 CCACCTGTTGTACACGGAGTGCA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932775843 Original CRISPR TGCACTCCGTGTACAACAGG TGG (reversed) Exonic
900385000 1:2406507-2406529 TGCACTCCCAGCAGAACAGGTGG + Exonic
900970465 1:5989877-5989899 TGCCCTCCTAGTACAGCAGGGGG - Intronic
1070351699 10:75598964-75598986 TGCATTCCTTGTCCATCAGGTGG + Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG + Exonic
1091410078 12:233437-233459 TGCACTCCCTCTACTACAGCGGG - Intronic
1100832619 12:98530954-98530976 TGCACTCTTTTTACAACAGGTGG - Intronic
1101299710 12:103466651-103466673 TGCAATCAGTGTACCACATGGGG - Intronic
1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG + Intronic
1107545565 13:41430576-41430598 TGTACACCGTGTAACACAGGAGG + Intergenic
1126382568 15:48064501-48064523 TTTACTCCGTGTCCAAGAGGTGG - Intergenic
1126465334 15:48956477-48956499 TGGACTTGGTGTCCAACAGGAGG - Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1137976767 16:53038683-53038705 TGCACCCCCTGTACAACAACGGG + Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
930608327 2:53515100-53515122 TGCACTCCGTGAACACCACTAGG + Intergenic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
953902283 3:46850112-46850134 TGCAGTCCGTCTTCAAGAGGGGG - Intergenic
956329247 3:68087122-68087144 TGCAATTCCTGTACAACAGTAGG - Intronic
956462105 3:69482919-69482941 TGCTCTTTCTGTACAACAGGGGG - Intronic
959464984 3:106674736-106674758 TGCATTGGGTGTACAACAAGTGG + Intergenic
960593003 3:119383132-119383154 TGCAGTCCGGGTCCAGCAGGTGG + Exonic
961794892 3:129402424-129402446 TGCACTCCTGGCACAACAGCTGG - Intronic
966276909 3:178184076-178184098 TGCACTCCTTCTTCAAAAGGTGG - Intergenic
975692864 4:76983085-76983107 TGCAGAGCGTGTACACCAGGGGG - Intronic
1002858342 6:1057613-1057635 TGAGCTCCGTGTAACACAGGAGG - Intergenic
1010354219 6:74911434-74911456 TGTTCTCCGTGTAATACAGGAGG + Intergenic
1045034283 8:98165330-98165352 TGCACACTGTATACACCAGGTGG + Intergenic
1049213930 8:141399136-141399158 AGCACACCGTGTGCCACAGGAGG - Intronic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG + Intronic
1057934785 9:99227907-99227929 TGCACTCCTTGTCCCACAGCTGG - Exonic