ID: 932775846

View in Genome Browser
Species Human (GRCh38)
Location 2:74527963-74527985
Sequence CCTCATTCGCTTCCCCTAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 91}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932775838_932775846 22 Left 932775838 2:74527918-74527940 CCCTGTCTGTGCACCCGACCACC 0: 1
1: 0
2: 0
3: 8
4: 115
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91
932775844_932775846 1 Left 932775844 2:74527939-74527961 CCTGTTGTACACGGAGTGCAAAC 0: 1
1: 0
2: 0
3: 6
4: 33
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91
932775841_932775846 9 Left 932775841 2:74527931-74527953 CCCGACCACCTGTTGTACACGGA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91
932775842_932775846 8 Left 932775842 2:74527932-74527954 CCGACCACCTGTTGTACACGGAG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91
932775843_932775846 4 Left 932775843 2:74527936-74527958 CCACCTGTTGTACACGGAGTGCA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91
932775836_932775846 28 Left 932775836 2:74527912-74527934 CCTCCACCCTGTCTGTGCACCCG 0: 1
1: 0
2: 0
3: 23
4: 240
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91
932775839_932775846 21 Left 932775839 2:74527919-74527941 CCTGTCTGTGCACCCGACCACCT 0: 1
1: 0
2: 0
3: 9
4: 115
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91
932775837_932775846 25 Left 932775837 2:74527915-74527937 CCACCCTGTCTGTGCACCCGACC 0: 1
1: 0
2: 0
3: 17
4: 186
Right 932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932775846 Original CRISPR CCTCATTCGCTTCCCCTAGT TGG Exonic
900083288 1:874965-874987 CCTCATTCTCTTCACCAGGTGGG + Intergenic
905625486 1:39488114-39488136 CCTAATTTGCTTCCCCTTCTAGG + Intergenic
908935057 1:69365124-69365146 CCTCATATGCTTCCTCTGGTAGG + Intergenic
909203085 1:72717080-72717102 CCTGATGGGCTTCCCCTTGTAGG + Intergenic
913020866 1:114788694-114788716 TCTGATTGGCTTCCCCTTGTAGG + Intergenic
920675749 1:208037531-208037553 CCTGAGGCGCTTCCTCTAGTTGG + Intronic
924276624 1:242395285-242395307 CCTTATTCCCTTCCCCTACGAGG + Intronic
1067212790 10:44274905-44274927 CCTCATGGGCTTCCCTTTGTGGG - Intergenic
1069293359 10:66811488-66811510 ATTCTTTAGCTTCCCCTAGTGGG + Intronic
1069982327 10:72261034-72261056 CGTCCCCCGCTTCCCCTAGTAGG + Intergenic
1071263364 10:83941505-83941527 CCCCATTCCCTTCCAATAGTAGG + Intergenic
1073991470 10:109266985-109267007 CCACATTGGCTGCCCCTATTGGG + Intergenic
1077001126 11:322924-322946 CCTCATTCCCTTCCCCTCTGAGG + Intronic
1081202015 11:40227898-40227920 CATCATTCTCTTCACCTAGCAGG - Intronic
1082218486 11:49603549-49603571 CCTCATTCAATTACACTAGTAGG - Intergenic
1084725575 11:70939677-70939699 CCTCATTCCCTTCCCCATGATGG + Intronic
1086274599 11:85110829-85110851 CCTCATTTGACTCCCCTTGTAGG - Intronic
1086631089 11:89020566-89020588 CCTCATTCAATTACACTAGTAGG + Intronic
1087239735 11:95761470-95761492 GGTCATTCTCTTCCCCTACTTGG + Intergenic
1097276558 12:57817591-57817613 CCTTGTCCCCTTCCCCTAGTTGG - Intronic
1103992331 12:124807625-124807647 CCTCATTATCTTCGCCTAATGGG + Intronic
1107439151 13:40409079-40409101 TCTCATCAGCTTCCCCAAGTAGG + Intergenic
1107460790 13:40599985-40600007 CCTCTTTCTCTTCCCCTGGTTGG - Intronic
1108528743 13:51308957-51308979 CTTCATTCACTTCCCCTAATTGG + Intergenic
1111056257 13:82954414-82954436 TCTCATTGGCTTCCCTTTGTAGG - Intergenic
1119696614 14:76718541-76718563 CCTCAGTAGCTTCCCAAAGTGGG - Intergenic
1125030781 15:35073860-35073882 CCTCACTCGGTTGCCCAAGTTGG + Intergenic
1127387293 15:58476839-58476861 CCTCAGTTGCTGCCCTTAGTAGG + Intronic
1128467128 15:67922245-67922267 CCTCATTCTCTTGCCCAGGTTGG + Intergenic
1129691145 15:77714299-77714321 CCTCACTCTCTTTCCCTACTTGG + Intronic
1130457524 15:84127767-84127789 CCTCATTCTCATCCCGTACTAGG - Intergenic
1142667981 17:1473339-1473361 TCTCATCCTCTTCCCCTAGGTGG - Intronic
1145861392 17:28213340-28213362 CCTGATTGGCTTCCCTTTGTGGG - Intergenic
1146004427 17:29151914-29151936 CCTCCTTTGCTTCATCTAGTTGG - Intronic
1163278026 19:16297733-16297755 CCTCATTCCCTGCCCCTGGTTGG - Intergenic
1166094153 19:40529320-40529342 CCTCCTTCGTTTCCCGGAGTCGG - Intronic
929897946 2:45977906-45977928 CCTCACTCGCTCTCCCCAGTTGG - Intronic
930680708 2:54254654-54254676 CATCATTCGCTTCGCTTAGAAGG + Exonic
930758507 2:55004836-55004858 CCTCATGCCCTTCCCTTAGGGGG + Intronic
932775846 2:74527963-74527985 CCTCATTCGCTTCCCCTAGTTGG + Exonic
936061293 2:109297350-109297372 CCTCCTTCCCTTCCCCTCTTTGG - Intronic
936586494 2:113762941-113762963 CCTCATTACCATGCCCTAGTTGG - Intergenic
940472884 2:154121089-154121111 CTTTATTCCCTTCCCCAAGTCGG - Intronic
940819156 2:158332384-158332406 TCTCATGGGCTTCCCCTTGTGGG + Intronic
941070127 2:160946088-160946110 CCTCATTCAATTCACCTATTTGG + Intergenic
941209642 2:162621429-162621451 CCTCTTTCTCTTCCCCATGTTGG - Intronic
942371322 2:175288717-175288739 TCTGATTCCCTTCCCCTTGTGGG + Intergenic
942682804 2:178495855-178495877 CCTCATTCCCTTCTCCTTGGAGG + Intronic
944875339 2:203958982-203959004 CTTCATTTGCTTCTCCTTGTTGG - Intronic
946113472 2:217440636-217440658 CCTCATTTTCTTCCCCTTTTTGG + Intronic
946426639 2:219601913-219601935 CCTCATCCCCATCCCCTAGTTGG - Intronic
947347622 2:229209478-229209500 CCTCATTGACTGCACCTAGTTGG - Intronic
948553355 2:238790902-238790924 CCTCAAACGCTCCCCCTTGTTGG - Intergenic
1169354912 20:4898117-4898139 CCACATCTCCTTCCCCTAGTCGG + Intronic
1171866359 20:30489311-30489333 CCTCCTCCGCTTCCCCTTGATGG - Intergenic
1173089936 20:39960956-39960978 CCTCATTCTCTTCTCCTTTTGGG + Intergenic
1173717154 20:45218528-45218550 TCTCATTCCCTTCCTCTCGTAGG - Intergenic
1174919014 20:54682453-54682475 CCTGCTTCTCTTCCCCCAGTGGG + Intergenic
1177280978 21:18982939-18982961 CCTCACTGGCTTCACATAGTAGG - Intergenic
1183222440 22:36524605-36524627 TCTCATTCGATTCCGCTGGTAGG + Exonic
1183945019 22:41320531-41320553 TCTCATTCCCTTCCCCATGTCGG - Intronic
950333267 3:12174069-12174091 CATCATTGGCTTCCCCTTCTTGG + Intronic
956424410 3:69118570-69118592 GCTCATTGGCTTCCCCCAGTTGG + Intronic
958994671 3:100890347-100890369 CCTCATTCCCTTCCTCTAAAGGG + Intronic
960567902 3:119155010-119155032 CCTGATTGGGTTCCCCTTGTAGG + Intronic
963231059 3:142909209-142909231 CCTCATTCACTTCCTGTACTTGG - Intergenic
967145581 3:186603222-186603244 CCTCATTGGGTTCCCTGAGTTGG + Intergenic
970432386 4:16000948-16000970 CCTTATTGGCTACCCCTCGTGGG - Intronic
974801958 4:66829023-66829045 CCTCAGTGGCTTTCTCTAGTTGG - Intergenic
977120382 4:93092440-93092462 CCTCTTTGGCTTTCCCTACTAGG + Intronic
981702002 4:147617464-147617486 CTTCAGTCGATTCCGCTAGTAGG - Exonic
988439376 5:31214401-31214423 CCTCATCCAAATCCCCTAGTTGG - Intronic
989954678 5:50343754-50343776 CCTCCTACCCTTCCCCTAGTTGG - Intergenic
994340325 5:98619108-98619130 TCACATTCCCTTCCCATAGTTGG - Intergenic
995743834 5:115383065-115383087 CCTCATTTGCTTACTCTAGCTGG - Intergenic
996549773 5:124717878-124717900 CCTCCTTCGCTGCCCCTATAGGG - Intronic
998780643 5:145652514-145652536 TCTCATGGGCTTCCCCTTGTGGG - Intronic
999362400 5:150997185-150997207 CCTCTGGGGCTTCCCCTAGTGGG + Intergenic
1000488094 5:161873377-161873399 CTTCATTCCCTTCCACTTGTAGG + Intronic
1000987947 5:167881557-167881579 CATCATTCACTTTCCCAAGTTGG + Intronic
1001092003 5:168748478-168748500 GCTCACTGGCTCCCCCTAGTGGG - Intronic
1004919740 6:20365317-20365339 GCACATTTGCTTCTCCTAGTCGG + Intergenic
1005568571 6:27122491-27122513 CCTCATTTGCTTCATCTTGTAGG - Intergenic
1005800053 6:29411543-29411565 CCTCATACGGTTCCCTTTGTAGG - Intronic
1012577828 6:100825480-100825502 TCTCATAGGCTTCCCCTTGTGGG + Intronic
1019160249 6:170064532-170064554 GCTCTTTCCCTTCCTCTAGTGGG - Intergenic
1019225326 6:170503524-170503546 CATCATTCCCTTCCCCTAGTGGG - Intergenic
1019225363 6:170503668-170503690 CATCATTCCCTTCCCCTGATGGG - Intergenic
1019225459 6:170504100-170504122 CCTCATTCCCTTCCCCTGATGGG - Intergenic
1022514305 7:30965676-30965698 CCTCAGTTGCTTCCCCAAATTGG + Intronic
1023932254 7:44713065-44713087 CCTTATTCCCTTCCCCTGCTGGG + Intergenic
1027456146 7:78394307-78394329 ATTCATTCCCTTCCCCTACTAGG + Intronic
1029167059 7:98599747-98599769 CCTCAGCCACTTCCCCCAGTAGG - Intergenic
1029178918 7:98685357-98685379 CCTCACTGGCTTCCTCTACTTGG + Intergenic
1040317261 8:46271016-46271038 CTTCATCTGCTTCCCCAAGTGGG - Intergenic
1041713708 8:60914894-60914916 CCTCAGGCAGTTCCCCTAGTGGG + Intergenic
1053410569 9:37913890-37913912 CCTCATTGGCTCCCCCAAGTGGG - Intronic
1191676816 X:63799514-63799536 TCTGATTGGCTTCCCCTTGTGGG - Intergenic
1191754050 X:64575116-64575138 GCTCATTAGCACCCCCTAGTAGG + Intergenic
1191956606 X:66649209-66649231 CCTGATGGGCTTCCCCTTGTGGG + Intergenic
1196384737 X:115137299-115137321 CCTCATTCCCATCACCTAATTGG - Intronic