ID: 932775847

View in Genome Browser
Species Human (GRCh38)
Location 2:74527974-74527996
Sequence TCCCCTAGTTGGCGATGAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932775841_932775847 20 Left 932775841 2:74527931-74527953 CCCGACCACCTGTTGTACACGGA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 27
932775842_932775847 19 Left 932775842 2:74527932-74527954 CCGACCACCTGTTGTACACGGAG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 27
932775843_932775847 15 Left 932775843 2:74527936-74527958 CCACCTGTTGTACACGGAGTGCA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 27
932775844_932775847 12 Left 932775844 2:74527939-74527961 CCTGTTGTACACGGAGTGCAAAC 0: 1
1: 0
2: 0
3: 6
4: 33
Right 932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932775847 Original CRISPR TCCCCTAGTTGGCGATGAAC AGG Exonic
903008529 1:20314407-20314429 TCCCCAGGTTGGCCACGAACAGG - Exonic
918668966 1:187188979-187189001 TCTCCAATTTGGCAATGAACAGG + Intergenic
1078947408 11:16085143-16085165 ACCCCTATTTGGCCATGAAGAGG + Intronic
1083159619 11:60847039-60847061 TCCCCCAGTTGGAGATGAAGTGG - Intronic
1083307332 11:61768205-61768227 TCCTCTACTTGGAGATGTACTGG - Intronic
1088568345 11:111196764-111196786 TCCCCTAGTTGGAGTTCAGCAGG + Intergenic
1098611304 12:72461856-72461878 TCCCCAAGGTGGGGAAGAACTGG + Intronic
1102172589 12:110853397-110853419 TCCCCCAGTTGAAGAAGAACAGG + Exonic
1106377720 13:29204881-29204903 TCCCCGATTTGGCGAGGCACTGG - Intronic
1127127602 15:55827382-55827404 GCCCCTAGTGGGAGATGAAGGGG + Exonic
1133293092 16:4735434-4735456 TGCCCTGATTGGGGATGAACGGG + Intronic
1140972318 16:80025236-80025258 ACCCCTGGTTGGAGATCAACAGG + Intergenic
1166181331 19:41111375-41111397 TCCTCCAGTTGGCGATGGAATGG + Intergenic
928615525 2:33035089-33035111 TCCCCTTGTTGCCGATGGATAGG + Intronic
930428802 2:51247435-51247457 TCCTCTAGATGGCGATGAAAGGG - Intergenic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
1170020410 20:11831076-11831098 TCACCTATTTGGGGATGGACTGG - Intergenic
1176917247 21:14640962-14640984 TCGACTAGTTGGCCATGAAATGG + Intronic
1178743463 21:35225006-35225028 TCCCCTAAATGGCAATGAGCTGG - Intronic
1183771112 22:39926807-39926829 TCCCCTAATTGGCAGTGATCAGG - Intronic
953882074 3:46695790-46695812 TCCCCTAGATGTGGCTGAACAGG - Intergenic
954584640 3:51722517-51722539 TCCCCCAGGTGGCGATGAAGCGG + Intergenic
955592495 3:60552623-60552645 TTACCAAGTTGGCAATGAACAGG - Intronic
955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG + Exonic
975590958 4:75999504-75999526 GCCCCAATTTGGCGCTGAACGGG - Intergenic
982105733 4:152010561-152010583 TGCTCTAGTTGGCGATGAGGAGG - Intergenic
985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG + Intronic
986389588 5:7272181-7272203 TCTCCTAGTTTGCCATGAAATGG - Intergenic
1005350636 6:24931497-24931519 TCTCCCAGATGGAGATGAACTGG - Intronic
1041794632 8:61733949-61733971 TCTACTAGTTGGTGATGAGCTGG + Intergenic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic