ID: 932776344

View in Genome Browser
Species Human (GRCh38)
Location 2:74530268-74530290
Sequence GCCTCCCGGGTCCTGGTATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932776344_932776348 -8 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776348 2:74530283-74530305 CGGGAGGCCTCAGAGAACTCTGG 0: 1
1: 0
2: 1
3: 42
4: 189
932776344_932776357 28 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776357 2:74530319-74530341 GCGTGGCTGGCGGTGGCGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 250
932776344_932776351 15 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776351 2:74530306-74530328 AACCCGTTCGCGCGCGTGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 9
932776344_932776355 21 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776344_932776350 11 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776350 2:74530302-74530324 CTGGAACCCGTTCGCGCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 16
932776344_932776354 18 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776354 2:74530309-74530331 CCGTTCGCGCGCGTGGCTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 37
932776344_932776356 27 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776356 2:74530318-74530340 CGCGTGGCTGGCGGTGGCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932776344 Original CRISPR GCCTCCCGGGTCCTGGTATC TGG (reversed) Exonic
900556312 1:3282622-3282644 GCCTTCCTGGTCTTGGTGTCTGG + Intronic
900563030 1:3317450-3317472 GCCGTCAGGGTCCTGGTGTCCGG + Intronic
901186147 1:7374702-7374724 CTCTCCAGTGTCCTGGTATCTGG - Intronic
901427131 1:9189402-9189424 GCCTCCAGGCCCCTGGTCTCGGG - Intergenic
902219331 1:14954861-14954883 GCCTCCTGGGTCCTGGGTTCCGG - Intronic
903438089 1:23367828-23367850 GCCTCCAGGGGCCTAGTACCAGG - Intronic
905075006 1:35262681-35262703 GCCTCCCGGGTTCAAGTAGCTGG + Intergenic
907486655 1:54782605-54782627 GACTCCTGGGTCCTGGCCTCAGG - Intronic
912762614 1:112382488-112382510 GCCTCCCGAGTCCGAGTAGCTGG - Intergenic
914373382 1:147050771-147050793 GCCTCCCCCGGCCTGGTACCCGG - Intergenic
919639653 1:200035941-200035963 GCCTCCCGGGTTCTAGTCTCTGG + Intronic
920070155 1:203296850-203296872 GCCTCCAGGGTCCTGGATGCAGG - Intergenic
922773988 1:228206766-228206788 GGCTCCCTGGTGCTGGTAGCTGG + Intronic
924418772 1:243887543-243887565 GCCTCCCGGGTTCACGTAGCTGG + Intergenic
924786467 1:247204421-247204443 GGCTCCCGTTTCCTGGTATTGGG - Intergenic
1063290725 10:4744224-4744246 GCCTCCTGTGTCTTGGCATCTGG - Intergenic
1064059986 10:12129503-12129525 GCCTCCCGGGTCCCGGGTCCTGG + Intergenic
1064059992 10:12129510-12129532 GGGTCCCGGGTCCTGGGACCGGG + Intergenic
1076356544 10:129857686-129857708 GCAGCCCGGGGCCTGGTATCTGG - Intronic
1077179146 11:1204404-1204426 GCCTCCCAGGTCCCCTTATCTGG - Intergenic
1077327380 11:1969597-1969619 GCCCGCCGGGTCCTGGCCTCAGG - Intronic
1080317577 11:30967568-30967590 GGCTCCTGGGGCCTGGGATCTGG + Intronic
1082003780 11:47408757-47408779 GACTCCCGGGTCCTGGGAGCCGG - Intronic
1083801033 11:65046399-65046421 GCCTCTCCTGTCCTGGTCTCAGG + Intronic
1084287589 11:68142047-68142069 GCCTCCTGGGGCCTGGCACCCGG - Intergenic
1088612667 11:111592807-111592829 GCCTCCCATGACCTGGTCTCAGG + Intergenic
1089377993 11:118008418-118008440 GCCTCCTGGCTCCTGGCACCAGG + Intergenic
1091118783 11:133039612-133039634 ACCTCCCTGGTCCTGGCATCTGG - Intronic
1202810362 11_KI270721v1_random:24777-24799 GCCCGCCGGGTCCTGGCCTCAGG - Intergenic
1096435745 12:51590503-51590525 GCCTCCCCGCTCCTGGCAGCAGG + Intronic
1097074612 12:56383666-56383688 TCCTCGCTGGTCCTGGGATCTGG + Intergenic
1097192178 12:57224889-57224911 GCCTTCCGGACTCTGGTATCTGG - Exonic
1101263479 12:103059492-103059514 GCCTGCCAGGTTTTGGTATCAGG - Intergenic
1101395238 12:104341469-104341491 GCCTGACGGGTCCTAGGATCAGG + Intronic
1101778854 12:107817662-107817684 TCCTCCTGGGTCCTGGAATTTGG + Intergenic
1107036232 13:35905414-35905436 GCCTCCTGGCTCCTGGGATAGGG - Intronic
1112532060 13:100214537-100214559 GCCTCCGGCTCCCTGGTATCTGG + Intronic
1112882154 13:104121260-104121282 GCCTTCCTGGTTCTGGTATTAGG + Intergenic
1115641013 14:35335636-35335658 GCCTTCCTGGGCCTGGCATCAGG + Intergenic
1122921079 14:104880409-104880431 GCCTACCTGTTCCTGGTCTCCGG - Exonic
1123006453 14:105326187-105326209 GCCTCCCTGGTCCTGGATACAGG + Intronic
1127039586 15:54959791-54959813 GCCTCCCAGGTGCTGGAGTCTGG - Intergenic
1127070504 15:55283937-55283959 GCCTCCCAGGTGGTGGGATCAGG + Intronic
1129164662 15:73769714-73769736 GCCTCCAGGCTCCTGGCAACTGG - Intergenic
1130017868 15:80201520-80201542 GCCTCCTGGGTCCTGGTCCAGGG + Intergenic
1132223321 15:100121760-100121782 TTCTCCCTGGTCCTGGTATGTGG + Intronic
1132240157 15:100251647-100251669 GCCTCCCGGGTTCTGGCTCCCGG - Intronic
1134508142 16:14824519-14824541 GCTTCCCGGGTCCAGGAATTTGG + Intronic
1134695840 16:16223284-16223306 GCTTCCCGGGTCCAGGAATTTGG + Intronic
1134975986 16:18571404-18571426 GCTTCCCGGGTCCAGGAATTTGG - Intergenic
1135565808 16:23510238-23510260 GCCTCCCGGGGCCTTGCTTCGGG - Intronic
1136576925 16:31130615-31130637 GCCTCCCGGGCCCTGGGGGCAGG + Intronic
1141906815 16:87032172-87032194 GCCTCCCAGGTACTGGTGACTGG + Intergenic
1142367863 16:89659596-89659618 GCCTCCCGGGTCCCGGTTCAAGG - Intronic
1144495278 17:15741736-15741758 GCCTCCTGGGTCCAGGTGCCAGG - Intronic
1145975198 17:28979800-28979822 GCCTCCCAGGCCCTTGTAGCTGG - Exonic
1147248718 17:39139655-39139677 ACCACCCTGGTCCTGTTATCTGG + Exonic
1148323466 17:46770928-46770950 GGCTCCCGGGTCCTGCCATGAGG - Intronic
1149865684 17:60149898-60149920 GCCTCCCGCGTCCAGCTGTCGGG + Intergenic
1152265133 17:79289695-79289717 GCCTCCCAGCTCCTGGCCTCTGG + Intronic
1152579508 17:81159869-81159891 CCCTCCCTGTCCCTGGTATCGGG - Intronic
1155764727 18:29614065-29614087 CTCTCCCTGGTCTTGGTATCAGG + Intergenic
1158555944 18:58474885-58474907 ACCTCCTGGGTCCTGGGATTTGG + Intergenic
1161812129 19:6477015-6477037 GCATCCCCGGTCCGGGTTTCGGG + Intronic
1163192539 19:15687967-15687989 GCCTCCCGGGTTCTGGTCAAGGG - Intronic
1163851585 19:19667366-19667388 GCCTCCCGAGTCCGAGTAGCTGG - Intergenic
1164705219 19:30314556-30314578 GCCTCCCAGATCCTGGGAGCTGG - Intronic
1164937247 19:32224209-32224231 CTCTCCCGGGTCATGGTAGCGGG - Intergenic
1166252238 19:41579125-41579147 GGCTCCCTGGTCCTGGTCTGAGG + Intronic
1166276643 19:41758561-41758583 GTCTCCCTGGTCCTGGTCTGGGG + Intronic
1166281944 19:41799968-41799990 GTCTCCCTGGTCCTGGTTTGTGG + Intronic
1167008107 19:46788364-46788386 GCCTCCCGGATCCAGGCGTCCGG - Exonic
1167529866 19:50008556-50008578 GCCTCCCGTGTCCTGGGCACTGG + Intronic
927708315 2:25310577-25310599 GCCTCCCTGATCCTGGGCTCCGG + Intronic
929950809 2:46408371-46408393 GTCTCCCCGGTCCTGGTTTGTGG - Intergenic
932776344 2:74530268-74530290 GCCTCCCGGGTCCTGGTATCTGG - Exonic
935301304 2:101696592-101696614 GCCTCCCGAGTTCTCGTTTCAGG - Intergenic
936344591 2:111665675-111665697 GCCCGCCTGGTCCTGGCATCAGG + Intergenic
939166197 2:138643652-138643674 GCATCCTGGGTCCTGCTTTCAGG - Intergenic
942131582 2:172885344-172885366 GCCTCCCAAGACCTGGTCTCTGG + Intronic
942947336 2:181684337-181684359 GGCTCCCGGGTCCTGGCCTGAGG + Intergenic
943007279 2:182401188-182401210 CCCTCCTGGGTTTTGGTATCAGG - Intronic
947793486 2:232880505-232880527 TCCTGCCGGGTCCTGGTAGAAGG - Intronic
1172182046 20:33009589-33009611 GCCTTCCGGGACCTCATATCCGG + Intronic
1173855942 20:46250993-46251015 GTCCCCAGGGTCCTGGGATCTGG + Intronic
1175133842 20:56808545-56808567 GCCTCCCGGGTGCTGTTTCCGGG + Intergenic
1180981297 22:19879368-19879390 GCCTGCCGGGCCGTGGTAGCTGG - Intronic
1181818909 22:25460418-25460440 GCCTCCCGTGGCCTGGAATGGGG + Intergenic
1182422283 22:30254377-30254399 GCCTCCCGGGTCCTGTTTTAGGG - Intergenic
1185208164 22:49552049-49552071 GCATCCCGGGGCCTGGTGCCCGG - Intronic
1185400637 22:50613762-50613784 CGCTCCCGGGCCCTGGTCTCGGG + Intronic
950090800 3:10292834-10292856 GCCTCCAGGGTCCAGGTAAGTGG - Exonic
950329935 3:12148211-12148233 TCCTCCCGGGATCTGGGATCTGG + Intronic
952999814 3:38922259-38922281 GCCTCCAGGTTCCTGCTATCTGG - Intronic
961398166 3:126612565-126612587 GCCTCCCGGGTTCTCTTACCAGG + Intronic
966082933 3:176027763-176027785 GCCTCCCGGGTTCAGGGTTCAGG + Intergenic
966245873 3:177807792-177807814 CACTCCCGGGGCCTGGTATGGGG + Intergenic
966460059 3:180166347-180166369 GCCTCCCTGGCCATGCTATCAGG + Intergenic
967419242 3:189255499-189255521 GTCTACCGGGTTTTGGTATCAGG + Intronic
969529395 4:7722341-7722363 GCCTCCTGGGTCCTGGGCTTTGG + Intronic
974546955 4:63323617-63323639 GACTCCCAGGTCTTTGTATCTGG - Intergenic
976093116 4:81477603-81477625 TCCTCCCAGGTTTTGGTATCAGG - Intronic
982175481 4:152701979-152702001 TCATCCCCGGGCCTGGTATCAGG + Intronic
982317244 4:154044185-154044207 GCCTCCAGGGTCCTGGCCACGGG - Intergenic
985957671 5:3276950-3276972 GCCTCCTGGGTGCTGGGATCCGG + Intergenic
986040598 5:3990507-3990529 GCCTCCAAGGAGCTGGTATCTGG + Intergenic
988458067 5:31405284-31405306 GCCTCCCCGGTCCAGGTGTCAGG - Intronic
990699599 5:58460505-58460527 GCCTCCTGTGTCAAGGTATCAGG + Intergenic
997206354 5:132052494-132052516 GTCTCCTGGGTCCTGGTACCAGG + Intergenic
1001877054 5:175210678-175210700 TCCTCCTGGGTCCTGGCACCTGG - Intergenic
1001977101 5:176009120-176009142 TCATCCCAGGTCCAGGTATCAGG + Intronic
1002240326 5:177834660-177834682 TCATCCCAGGTCCAGGTATCAGG - Intergenic
1002319750 5:178367934-178367956 GCCTCCCAGGTCCTGCCACCTGG - Intronic
1003265264 6:4560314-4560336 GCTTCCAGGGTCCTGGCAGCAGG - Intergenic
1006861466 6:37174232-37174254 GCCTCCAGGGGCCTGGGATCTGG - Exonic
1012854415 6:104484869-104484891 GCCTGCAGGGTCCTGGGAACAGG - Intergenic
1023871149 7:44263622-44263644 GCCTCCGGTGTCCGGGGATCTGG - Intronic
1024731532 7:52258878-52258900 GCTTCCTGGGTCCTGGGATGGGG - Intergenic
1035557548 8:578124-578146 GTCTCCCGGGTCCTCGGATCTGG - Intergenic
1035643501 8:1201074-1201096 GCCTCCCCAGTGCTGGTCTCTGG - Intergenic
1041195801 8:55400377-55400399 ACCTCCCAGGTTCTGGTGTCTGG + Intronic
1046537521 8:115534072-115534094 GCCTCCAGTGTGATGGTATCGGG - Intronic
1046537527 8:115534107-115534129 GCCTCCAGTGTGATGGTATCAGG - Intronic
1047782771 8:128123386-128123408 GCCTCCCGGGGCCTGGCCTGGGG - Intergenic
1048452038 8:134541995-134542017 GCCTTCAAGGTCCTGGCATCTGG - Intronic
1049612714 8:143562860-143562882 GCCTCCCTGGCACTGCTATCAGG + Exonic
1050003841 9:1107146-1107168 GCCTGCCAGGTTTTGGTATCAGG + Intergenic
1056794452 9:89648020-89648042 GCCTCCCGGGTGCTTCTATCAGG - Intergenic
1057030160 9:91769284-91769306 GCCTCCCGTGTCCTCGTAAAAGG + Intronic
1060281676 9:122219496-122219518 GCCACCCGGCTGGTGGTATCCGG + Intronic
1061054484 9:128215165-128215187 ACCTCTCGGGTCCTGGCACCAGG + Intronic
1062151912 9:135024041-135024063 GCTTCCCAGGTCCTGTGATCTGG - Intergenic
1062187642 9:135227187-135227209 TCCTCCCTGGGCCTGGGATCTGG + Intergenic
1062454223 9:136628239-136628261 GCCTCCCAGGTGCTGGTGTTCGG + Intergenic
1062498125 9:136841114-136841136 GCCTCCCGGCTCCTGCCTTCGGG - Exonic
1062574949 9:137201674-137201696 GCCCTCAGGGTCATGGTATCCGG - Intronic
1190059045 X:47199246-47199268 ACATCCAGTGTCCTGGTATCAGG + Exonic
1193403222 X:81070488-81070510 ACATCCCGGGTCCTGTCATCGGG + Intergenic
1196602558 X:117619202-117619224 GCCTGCCAGGTTTTGGTATCAGG + Intergenic
1200153001 X:153960396-153960418 GTCTCCCAGGCCATGGTATCTGG + Exonic
1200209850 X:154342353-154342375 GCTTCCCGGGCCCTGATCTCAGG - Intergenic
1200221002 X:154389739-154389761 GCTTCCCGGGCCCTGATCTCAGG + Intergenic