ID: 932776344

View in Genome Browser
Species Human (GRCh38)
Location 2:74530268-74530290
Sequence GCCTCCCGGGTCCTGGTATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932776344_932776357 28 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776357 2:74530319-74530341 GCGTGGCTGGCGGTGGCGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 250
932776344_932776354 18 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776354 2:74530309-74530331 CCGTTCGCGCGCGTGGCTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 37
932776344_932776351 15 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776351 2:74530306-74530328 AACCCGTTCGCGCGCGTGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 9
932776344_932776348 -8 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776348 2:74530283-74530305 CGGGAGGCCTCAGAGAACTCTGG 0: 1
1: 0
2: 1
3: 42
4: 189
932776344_932776356 27 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776356 2:74530318-74530340 CGCGTGGCTGGCGGTGGCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236
932776344_932776350 11 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776350 2:74530302-74530324 CTGGAACCCGTTCGCGCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 16
932776344_932776355 21 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932776344 Original CRISPR GCCTCCCGGGTCCTGGTATC TGG (reversed) Exonic