ID: 932776345

View in Genome Browser
Species Human (GRCh38)
Location 2:74530275-74530297
Sequence CTCTGAGGCCTCCCGGGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 253}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932776345_932776351 8 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776351 2:74530306-74530328 AACCCGTTCGCGCGCGTGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 9
932776345_932776357 21 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776357 2:74530319-74530341 GCGTGGCTGGCGGTGGCGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 250
932776345_932776355 14 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776345_932776358 27 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776358 2:74530325-74530347 CTGGCGGTGGCGCTGGGCGCTGG 0: 1
1: 0
2: 1
3: 45
4: 424
932776345_932776361 30 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776361 2:74530328-74530350 GCGGTGGCGCTGGGCGCTGGGGG 0: 1
1: 0
2: 3
3: 43
4: 419
932776345_932776350 4 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776350 2:74530302-74530324 CTGGAACCCGTTCGCGCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 16
932776345_932776356 20 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776356 2:74530318-74530340 CGCGTGGCTGGCGGTGGCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236
932776345_932776359 28 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776359 2:74530326-74530348 TGGCGGTGGCGCTGGGCGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 271
932776345_932776360 29 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776360 2:74530327-74530349 GGCGGTGGCGCTGGGCGCTGGGG 0: 1
1: 0
2: 5
3: 73
4: 763
932776345_932776354 11 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776354 2:74530309-74530331 CCGTTCGCGCGCGTGGCTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932776345 Original CRISPR CTCTGAGGCCTCCCGGGTCC TGG (reversed) Exonic
900390168 1:2430392-2430414 CTCTGAGGTCTCTCTGCTCCCGG - Intronic
900488142 1:2933191-2933213 CTCTGGGGCCTCGGGGGTGCAGG + Intergenic
900958932 1:5907117-5907139 CTCTCAGGCCTCCCCGGCCCAGG - Exonic
901066612 1:6497379-6497401 CTCTGCGGCCTCCCAGTCCCCGG - Intronic
901087890 1:6622788-6622810 CACAGGGGCCTCCCAGGTCCAGG - Exonic
901639337 1:10685604-10685626 CTCTGAGGGCTCCCGGGTTGGGG - Intronic
901771853 1:11534591-11534613 CTCTGTGCCCTCCCGGCCCCAGG - Intronic
901772036 1:11535422-11535444 CTCTGAGGCCTCCAGGGCGGGGG + Intronic
902546628 1:17194355-17194377 CTCTGGGGCCTCGGGGCTCCTGG + Intergenic
903329291 1:22588944-22588966 CACTGCGGCCACCTGGGTCCAGG - Exonic
903883792 1:26529856-26529878 CTGCGCCGCCTCCCGGGTCCTGG - Intronic
903926083 1:26831712-26831734 CTCTGAGGCAGCCAGGGTCAGGG + Intronic
904055447 1:27667025-27667047 CTCTGAGGCCTCCAAAATCCTGG - Intronic
904474453 1:30755980-30756002 CTCTGATGCCTCTAGGGTCTGGG - Intronic
906380847 1:45331504-45331526 CTCTGAGGGCTCCCAGGTCACGG + Exonic
907268489 1:53276823-53276845 CTCTGCGGCCGTCCGGGCCCCGG - Exonic
914730279 1:150363996-150364018 CTCTGAAGCCCCCAGGGCCCAGG - Intronic
915915834 1:159940404-159940426 CCCTGAGTCCTCCTGAGTCCTGG + Intronic
916122937 1:161544976-161544998 AGCTGAGGCCTCCCGGGCCTGGG - Intronic
916132841 1:161626422-161626444 AGCTGAGGCCTCCCGGGCCTGGG - Intronic
920297334 1:204967083-204967105 CTCTGAGGCCTCCCAGCTCCTGG + Intronic
920521240 1:206628468-206628490 CTCAGTGGCCTCCAGGTTCCAGG - Intergenic
923934666 1:238747426-238747448 CTGTGAGGCCTTCCCGGTCATGG + Intergenic
924437137 1:244051389-244051411 CTCTGAGTCCTGCTGGCTCCAGG - Exonic
924907233 1:248469356-248469378 CTCTGAGGCATGCTGGCTCCGGG - Intergenic
1063056403 10:2509570-2509592 CTCTGATGACGCCTGGGTCCTGG - Intergenic
1063438108 10:6050750-6050772 CTCTGAGCACTCCCGGGCCAGGG - Intronic
1064569031 10:16673201-16673223 CTCTGAGTCCTACCAGGTACCGG - Intronic
1066057739 10:31697569-31697591 CTCTGAGCCCCCAGGGGTCCTGG - Intergenic
1067116301 10:43437536-43437558 CTCTCATGCCTCCTAGGTCCAGG - Intronic
1069615737 10:69805078-69805100 CTCCCAGTCCTCCGGGGTCCTGG - Intronic
1069661614 10:70127045-70127067 CTGTGGGCCCTCCTGGGTCCTGG - Intronic
1070842845 10:79499860-79499882 CTCTGAGGCCACAAGGGGCCTGG + Intergenic
1070902652 10:80044199-80044221 CTCTGCAGCCTCCCCTGTCCAGG - Intergenic
1071546979 10:86536561-86536583 TGCTGGGGCCTCCCGGGACCCGG + Intergenic
1072396654 10:95049926-95049948 CTCTGAGGCTTACCGGCTTCAGG + Intronic
1073030289 10:100520155-100520177 CACTGAGGGCTCCTGGGGCCAGG - Intronic
1073123131 10:101133913-101133935 CACGGAGGCCTCCCTGGCCCCGG - Intronic
1075399285 10:122149870-122149892 CTCTGAGGCCCACTGGGTCCGGG + Intronic
1075567309 10:123514044-123514066 CGCTGCAGCCTCCCTGGTCCTGG + Intergenic
1075697958 10:124449690-124449712 GGCTGAGGCCTCCTGGGGCCGGG + Intronic
1076554341 10:131311915-131311937 CTCCGCGGCCGCCCGGGTCCAGG - Intergenic
1076849529 10:133086247-133086269 CTCTGGGGCCTCCCAGAGCCTGG + Intronic
1076870707 10:133191897-133191919 CTTTGAGGCCACCTGGGGCCAGG - Intronic
1077418395 11:2436570-2436592 GTCTGAGGCCTCCCCAGCCCTGG - Intergenic
1077431903 11:2519994-2520016 CTCTGCGGGCTCCCGCGTCCTGG - Intronic
1078334188 11:10450923-10450945 CACTGAGGCCAGCCGGGGCCAGG - Exonic
1080436838 11:32252763-32252785 ATCTGAGTCTTCCCTGGTCCAGG - Intergenic
1080458513 11:32435225-32435247 CCCAGATGCCGCCCGGGTCCCGG + Exonic
1084311489 11:68318812-68318834 CTCTGAGCCCTGCAGGGCCCTGG - Intronic
1084519478 11:69654791-69654813 CTCTGGAGCCTCCCGGGGACAGG - Intronic
1085279982 11:75323761-75323783 CTCTGAGCCACCCAGGGTCCAGG + Intronic
1085726381 11:78958618-78958640 CTCTGAGGCCTACCAGATCTGGG + Intronic
1089856021 11:121545405-121545427 CTCATAGTCCTCCCGGGTGCAGG - Exonic
1089937162 11:122376025-122376047 CAGTGAGGTCTCCCAGGTCCTGG - Intergenic
1090400925 11:126447706-126447728 CTCTGAGGCCTGCCTGGCCACGG - Intronic
1091823332 12:3492056-3492078 CCGTGAGGGCTCCCGGGTCCCGG + Intronic
1091961265 12:4696628-4696650 CTCTCAGGGCTCCAGGGTCTTGG + Intronic
1096614555 12:52824401-52824423 CTCTGATGCTTCCTGGGGCCTGG - Intronic
1097175987 12:57143185-57143207 CTCTGAGGCCTCTAGGGCTCCGG + Intronic
1100338977 12:93660034-93660056 CTCTCAGTCCTCCCAGGGCCAGG + Intergenic
1103527379 12:121577861-121577883 CTCTGAGGCCTCCAGAGCCCTGG - Intronic
1103704075 12:122861988-122862010 GGCTCAGGCCTACCGGGTCCTGG - Exonic
1104304816 12:127600131-127600153 CTCTGAGGCCTCCCCAGCCATGG + Intergenic
1106720126 13:32427922-32427944 CTGCGAGGCCTCCCGGGCTCCGG - Exonic
1108787379 13:53921270-53921292 CTCAGGGGGCTCCCAGGTCCTGG + Intergenic
1112379927 13:98879065-98879087 CTCTGAGACCTGCAGAGTCCTGG - Intronic
1113847737 13:113402196-113402218 CCGTGTGGCCTCACGGGTCCGGG + Intergenic
1113913606 13:113856766-113856788 CCCTGAGAGCTCCCGCGTCCGGG + Intronic
1114412653 14:22515440-22515462 CTCAGAGTCCTCCAGAGTCCTGG - Intergenic
1120340614 14:83216794-83216816 CTCTGAACCCTCCCAGGCCCAGG - Intergenic
1121027251 14:90625628-90625650 ATTTGAGGCCTCCCAGCTCCAGG - Intronic
1121473717 14:94175056-94175078 CGCTGACGCCGCCCGGGTTCTGG + Intronic
1121718559 14:96093308-96093330 CTCTGGGACCTCCAGGGACCTGG + Exonic
1122287142 14:100658739-100658761 CTCTGTGTCCTCCAGGGTGCTGG + Intergenic
1122651082 14:103227398-103227420 CTCTGAGGTCTCCAGGGAGCAGG - Intergenic
1122881556 14:104692681-104692703 CTGGGAGGGCTCCGGGGTCCAGG - Intronic
1122974757 14:105166500-105166522 CTCTGGGGCCCCCCTGGTCAAGG + Intronic
1123112828 14:105881098-105881120 CTCTGGGGCCTCCTGGGTAGGGG + Intergenic
1123115168 14:105891252-105891274 CTCTGGGGCCTCCTGGGTGGGGG + Intergenic
1123117352 14:105900699-105900721 CTCTGGGGCCTCCTGGGTGGGGG + Intergenic
1123119443 14:105909968-105909990 CTCTGGGGCCTCCTGGGTGGGGG + Intergenic
1123139672 14:106062673-106062695 CTCTGAGACCTGCAGGGTCAGGG + Intergenic
1123404361 15:20011214-20011236 CTCTGGGGCCTCCTGGGTGGGGG + Intergenic
1123449121 15:20349385-20349407 CTCTGAGGCATCTCGGGTCCGGG + Intergenic
1123513696 15:21017861-21017883 CTCTGGGGCCTCCTGGGTGGGGG + Intergenic
1124427110 15:29571123-29571145 CTCTCCCGGCTCCCGGGTCCCGG - Intergenic
1126464346 15:48947596-48947618 CTCAAAGGCCTCCAGGATCCTGG - Intronic
1127534157 15:59874425-59874447 CTCTGAGGCCTCCTGGAACCAGG - Intergenic
1128320484 15:66690379-66690401 CTCTGAGGACACCCTGCTCCTGG + Intergenic
1129299360 15:74616368-74616390 CTCTGAGACCCCCTGGGACCTGG + Intronic
1129706427 15:77797110-77797132 CTCTGAGGCGTCCATGGTGCAGG + Intronic
1131053801 15:89363997-89364019 CTCTGGGACCTCCTGGGTGCAGG + Intergenic
1131461178 15:92618450-92618472 CTGTGGGGTCTCCTGGGTCCAGG + Exonic
1132155516 15:99492923-99492945 CTCAGAGGCCTGCTGGGACCTGG + Intergenic
1132343202 15:101090998-101091020 ACCTGTGGCCTCCTGGGTCCCGG - Intergenic
1132576657 16:667379-667401 CTCTGAGTGCTGCCTGGTCCTGG + Intronic
1132656803 16:1044876-1044898 CTCTTTGGCCTCCCAGGCCCAGG + Intergenic
1132859459 16:2062862-2062884 CTCTGGGTCCTCCCGCGGCCAGG - Intronic
1133024269 16:2980825-2980847 CCCTACGGCCTCCTGGGTCCCGG + Intergenic
1133202439 16:4212513-4212535 CTCTGCGGCCTCCCTGCTCCAGG - Intronic
1133338314 16:5020866-5020888 CTTGGAGGCCTCCTGGGGCCTGG + Intergenic
1136066366 16:27761564-27761586 CTCTGACGACTCCCGGGCCCTGG + Exonic
1138597283 16:58035763-58035785 CTTTGAGGCCTCTCAGGACCCGG - Intronic
1139357040 16:66372691-66372713 CGCAGAGGCCTCTGGGGTCCAGG - Intronic
1139470322 16:67174765-67174787 CTCTGGCTCCTCCGGGGTCCCGG - Exonic
1139614122 16:68078875-68078897 CTCTGGGGCCCCCAGGGTCTTGG - Exonic
1139699442 16:68698620-68698642 CTCTGAGGCAACCCTGGCCCAGG - Exonic
1141103255 16:81213129-81213151 CTCAGAGACTTCCCTGGTCCAGG - Intergenic
1141461020 16:84179018-84179040 CTCCCAGGCCTCCAGCGTCCGGG - Exonic
1141929787 16:87194384-87194406 TACTGAGGCCTGCAGGGTCCTGG + Intronic
1142122311 16:88392991-88393013 CTCTGAGGCCTCTCTGTGCCAGG - Intergenic
1142400442 16:89855709-89855731 CTCAGGGGCCGCCCGGGGCCTGG + Intronic
1142619183 17:1154220-1154242 CTCTAAGGCCTCAGGGGACCTGG + Intronic
1143259611 17:5588313-5588335 CTCAGAGCCCTCTCTGGTCCAGG + Intronic
1143750530 17:9023517-9023539 CTCTGAGCCCTCCCGGGTCCCGG - Intronic
1144850299 17:18240789-18240811 CTACGAGGCCTCACGGGACCTGG + Exonic
1144856045 17:18268461-18268483 CTCCCAGGGCTGCCGGGTCCTGG + Intergenic
1144954146 17:19010774-19010796 CTCTGAGGACACTGGGGTCCAGG - Intronic
1145007857 17:19347671-19347693 CTCTGGGGTCTCCAGGGGCCTGG - Intronic
1145122603 17:20273971-20273993 CTCTGAGGCCTCCAGGCTGATGG - Intronic
1146033987 17:29390517-29390539 ATCTGAGGCCTCCCGGCCCCGGG + Intronic
1146227342 17:31078388-31078410 CTCTAAGGGCTCCCGTGTCTTGG - Intergenic
1147120461 17:38332474-38332496 CTCTAAGACCTGCCAGGTCCAGG + Intronic
1147923213 17:43931378-43931400 TTCTGAGGCCACCTGGGGCCTGG + Intergenic
1148090906 17:45022049-45022071 GTCTGAGGCCGCCCGCGGCCTGG + Intergenic
1148986883 17:51630245-51630267 CTCTGAGTCCTGCTGGGTGCAGG - Intergenic
1151276345 17:73037456-73037478 CTCTGTGGCCTGCCCGTTCCAGG - Intronic
1151659959 17:75513898-75513920 CTTGGAGGGCTCCCGGTTCCGGG + Exonic
1151745255 17:76008465-76008487 CTCGGACTCCTCCCGGGACCAGG + Exonic
1152339526 17:79716479-79716501 CTCTGAGGCATCTCGGGTCCTGG - Intergenic
1152630971 17:81410571-81410593 CTCTGAGGCACCACGGGTCGAGG + Intronic
1152814400 17:82398922-82398944 CACTTTGGCCTCCCGGGTGCTGG + Intronic
1152904103 17:82961020-82961042 CTCTCAGGCGTCCCGGGGCCGGG + Intronic
1152923738 17:83078633-83078655 CTCTAGGGCCTCCCCAGTCCGGG + Intergenic
1154416672 18:14179077-14179099 CGCGGTGGCCGCCCGGGTCCCGG - Intergenic
1157753057 18:50195144-50195166 CTCTGAGCCCTGCCGGTGCCCGG + Intergenic
1159384698 18:67708058-67708080 CTCCTAGGCCTCCTGGGTCAGGG + Intergenic
1160698656 19:496349-496371 CTCTGCCGCCTCCAGGGTCGGGG + Intronic
1160834805 19:1119647-1119669 CTCTGGGCCCTCCCGGGTTGGGG - Intronic
1160905568 19:1450233-1450255 CTCCGAGGCCACCCCGGGCCGGG + Intronic
1161069369 19:2252698-2252720 CTCTGCAGCCTCCCGACTCCCGG + Exonic
1161102562 19:2428514-2428536 CCCGCAGGCCTCCCGGCTCCTGG + Exonic
1161333715 19:3700099-3700121 CTCGCAGGCCTCCCGCTTCCCGG + Intronic
1162551548 19:11361032-11361054 CTCTGAGGCCTCCTGCCCCCAGG - Intronic
1162917753 19:13883357-13883379 CTCTGAGGCCTCCAGGATGGAGG - Intronic
1163202649 19:15779818-15779840 GGCTGGGGCCTCCCGGCTCCTGG - Intergenic
1163333749 19:16658442-16658464 TTCTGGGGCCTCCAGGGCCCAGG + Intronic
1163695377 19:18761007-18761029 GCCTGAGGCCTCCAGGGTCTGGG + Intronic
1164639237 19:29812312-29812334 CACTGAGGCAGCCCGGGCCCCGG + Intronic
1166068066 19:40371735-40371757 CTTTGAGGCCTACTGGTTCCTGG + Exonic
1166432902 19:42741712-42741734 CTCTGAGCCCCCCGGGGTGCAGG + Intronic
1167529863 19:50008549-50008571 TCCTCAGGCCTCCCGTGTCCTGG + Intronic
1167679181 19:50909106-50909128 CTCTGGGGCTCCCCGGATCCAGG + Intronic
1167854533 19:52226971-52226993 CTCTGAGACCTCCTGGGGACAGG - Exonic
1168174622 19:54616430-54616452 ATCTGAGGCCTCACGTGTTCAGG - Intronic
926121371 2:10242978-10243000 GTTTGAGGCCTCCCGGAGCCGGG - Intergenic
926340116 2:11898381-11898403 CTCTGCCACCTCCCGGGTTCAGG - Intergenic
928424683 2:31168347-31168369 CTCTGAGTCCTCCCTTGTCAAGG + Intergenic
928813143 2:35253881-35253903 CTCTGAGGCTTCAAGGGTCATGG + Intergenic
930166337 2:48207102-48207124 CTTTGAAGACTCCCAGGTCCAGG - Intergenic
931250492 2:60527011-60527033 CTCTGAGGTCTCCCCGGTTATGG + Intronic
932218635 2:69983473-69983495 CTCTGAGGCCTCCTGCCTTCTGG - Intergenic
932462825 2:71894358-71894380 TTCTGAGGCCACCTGGGGCCAGG - Intergenic
932776345 2:74530275-74530297 CTCTGAGGCCTCCCGGGTCCTGG - Exonic
933047099 2:77553080-77553102 CTATGAGGGCTCCCCTGTCCAGG + Intronic
933666818 2:84971149-84971171 CTCTCGGGCCTGCCGGCTCCCGG - Exonic
933912033 2:86949845-86949867 CACTGCTGCCTCCCGGGTTCAGG + Intronic
933942222 2:87254183-87254205 CTCAGAGGGCTGCAGGGTCCTGG + Intergenic
934010961 2:87820052-87820074 CACTGCTGCCTCCCGGGTTCAGG - Intronic
934308594 2:91844484-91844506 CTCTGAGTCCCCTGGGGTCCCGG + Intergenic
935128106 2:100241542-100241564 CTCTCATGCCTCCCAGGTCAAGG - Intergenic
935394451 2:102591666-102591688 CTCTCCGGCCTCCCCGGCCCTGG - Intergenic
936338004 2:111607387-111607409 CTCAGAGGGCTGCAGGGTCCTGG - Intergenic
939524481 2:143275723-143275745 ATCAGAGGACTACCGGGTCCAGG - Intronic
948455875 2:238104431-238104453 TTCTGGGGACTCCTGGGTCCAGG - Intronic
948612389 2:239178192-239178214 CTCTGTGGCCGCACGTGTCCCGG + Intronic
1169132286 20:3172622-3172644 CTCTGAGGCCTCCCCAGGGCTGG + Intronic
1171421930 20:25023390-25023412 CTCTGAGGCTTCTCGGGTTGTGG - Intronic
1172173442 20:32958600-32958622 CTGTGAGTCTTCCCAGGTCCTGG + Intronic
1172245349 20:33442286-33442308 CTCTGGGGTCTCCCTGGTACTGG - Intronic
1173026349 20:39310838-39310860 CTGGGAGGCCTCCTGGGTCAAGG + Intergenic
1173554264 20:43954436-43954458 CTCTGAGGCCTGCAGGGGCTGGG + Intronic
1173822998 20:46030713-46030735 CTCTGAGGTCCTCCGGATCCTGG + Intronic
1174157777 20:48527981-48528003 CTCTGAGGCCTGCGGGACCCAGG - Intergenic
1174299513 20:49571293-49571315 CTTTGAGTCCTCCCGGGGCAGGG - Intergenic
1176012844 20:62909151-62909173 CTCTGGTCCCTCCAGGGTCCCGG - Intronic
1176307699 21:5132810-5132832 CTCTGAGGCCTGCCTAGTCCCGG + Intronic
1178355821 21:31909946-31909968 GCCTGAGGGCTCCCGGCTCCCGG - Intronic
1179515313 21:41902497-41902519 CTCTGGGGCCTCCTGGCTGCTGG - Intronic
1179849361 21:44129220-44129242 CTCTGAGGCCTGCCTAGTCCCGG - Intronic
1179996815 21:44977946-44977968 CTCTGGGGCCTCCTGGCTCCAGG + Intergenic
1180198105 21:46209330-46209352 CTCTGAGGCCTGCAGGGTGCTGG - Intronic
1180981298 22:19879375-19879397 CTCTGAAGCCTGCCGGGCCGTGG - Intronic
1181408180 22:22699926-22699948 TTCTGAGGCCACCTGGGTCTGGG - Intergenic
1181409787 22:22710852-22710874 CTCAGGGGCCTCCTGGGTCCAGG - Intergenic
1181417353 22:22770314-22770336 CTCAGGGGCCTCCTGGGTTCAGG - Intronic
1181423412 22:22817590-22817612 CTCATGGGCCTCCTGGGTCCAGG - Intronic
1181427861 22:22855862-22855884 CTCTGAGGCCACCAGGGGGCGGG + Intronic
1181810067 22:25398577-25398599 CTCTGAGCCCTGCGGGGCCCTGG + Intronic
1182144679 22:27990218-27990240 CTGTGTGGCCTCCTGGGGCCGGG + Intronic
1184113029 22:42406267-42406289 CCCTGAGGCCACCCTGATCCCGG + Intronic
1184648475 22:45908724-45908746 CTCTGGAGCCTCCTGGGTACTGG - Intergenic
1185179031 22:49348786-49348808 CTCGGAGGCAGCCAGGGTCCTGG - Intergenic
1185316558 22:50181708-50181730 CTCTGAGGCCTTGCTGGCCCTGG - Intergenic
1185345056 22:50307405-50307427 CGCGGAGGGCTCCCGGGGCCTGG - Intronic
949626736 3:5875603-5875625 CTCTCAGACCTCCAGGGTCCTGG - Intergenic
950090801 3:10292841-10292863 CGGAGAGGCCTCCAGGGTCCAGG - Exonic
954156182 3:48686042-48686064 CTCTGGTCCCTCCCGGCTCCAGG + Intronic
954412977 3:50379228-50379250 CTCTCAGCCCTCCCTGGTCCAGG + Intronic
954798639 3:53174462-53174484 CTCTGGGGCCTCCGTGGCCCAGG + Intronic
961041155 3:123679413-123679435 CTCTCAGGCCCCCAGGGTACAGG + Intronic
961650178 3:128413296-128413318 TTATGAGGCCTCCTGGGTACAGG + Intergenic
962693676 3:137926790-137926812 CTATGAGGACACCCAGGTCCAGG + Intergenic
963068326 3:141281481-141281503 CACTGAGGGCTGCCGTGTCCTGG - Intronic
968003737 3:195225306-195225328 CTCAGAGGCCTCCAGAGTGCTGG + Intronic
968289384 3:197526826-197526848 CTCTGTGGCCTCCAGACTCCAGG + Intronic
968466165 4:752529-752551 TCCTGAGGCCTCCGGGGACCGGG + Intronic
968879447 4:3291831-3291853 CCCTGTGGCTTCCCGGCTCCCGG + Intergenic
968919364 4:3514716-3514738 AACTGTGGCCTCCCCGGTCCTGG + Intronic
976491802 4:85679271-85679293 CTCTGAAGCCCCCCTTGTCCAGG - Intronic
978341060 4:107721371-107721393 ACCTGCGGCCTCCCCGGTCCTGG - Intergenic
982460970 4:155667857-155667879 CCCTGCTGCCTCCGGGGTCCAGG - Intronic
984607587 4:181803578-181803600 CTCAGATGCCTCCATGGTCCAGG + Intergenic
984956895 4:185053815-185053837 GTGTCAGGTCTCCCGGGTCCTGG - Intergenic
989103217 5:37839228-37839250 CTCTTGGGCATTCCGGGTCCAGG + Intronic
992714549 5:79496982-79497004 CACTGAAGCCTCCTGGGTTCAGG - Intronic
994060591 5:95472463-95472485 ATCTGTGTCCTCCGGGGTCCTGG - Intronic
994615564 5:102100038-102100060 CTCTGTGGCCTCTGGGGTCATGG - Intergenic
997303525 5:132823268-132823290 GTCTGAGGCCGCCCGGGCCAGGG + Exonic
997479717 5:134176354-134176376 GTCTGAGGCCGCCCGGTTCTTGG - Intronic
999155959 5:149457709-149457731 CTGTGAGGCCCCCCAGGTCATGG - Intergenic
1000652104 5:163830546-163830568 CTCTGAGTCCTTCAGGGTCCAGG - Intergenic
1000661818 5:163948057-163948079 CTCTGAGTCCTTCAGGGTCCAGG + Intergenic
1004267644 6:14163072-14163094 CTCTGCAGCCTCCCAGATCCAGG + Intergenic
1005328008 6:24720800-24720822 CTCGGGCGCCTCGCGGGTCCGGG + Exonic
1006173504 6:32108696-32108718 CTCTGGGGGCTCCAGGCTCCAGG - Intronic
1008379703 6:50827120-50827142 GTGTGAGGGCTCCCGGGTCCAGG + Intronic
1011670252 6:89676475-89676497 CTCTGATGCCTACAGGGGCCAGG + Intronic
1011966982 6:93171948-93171970 CCCTAAGGCCACCCAGGTCCAGG + Intergenic
1012475832 6:99613949-99613971 CTTTGAGACCGCCCGGGTCGAGG - Exonic
1014570215 6:122997972-122997994 CTTTGAGGCCTTCCGCCTCCTGG + Exonic
1018669560 6:166167708-166167730 CTGCGACGGCTCCCGGGTCCCGG + Exonic
1018909835 6:168095602-168095624 CTACCAGGCCTCCCGGGACCCGG + Intergenic
1019146298 6:169977541-169977563 CTCTCAGGCTCCCCGGGTGCAGG + Intergenic
1019499663 7:1358621-1358643 CTGTGAGGTCTCCCGGGCCTGGG - Intergenic
1022113439 7:27244797-27244819 CTCTAAGGCATCCTGGGTACAGG - Intronic
1022342899 7:29485776-29485798 CTCTGATGGCTCCAGGGCCCAGG - Intronic
1023177502 7:37448335-37448357 CTCGGCGGGCTCCCGGGCCCCGG + Intronic
1023388180 7:39681398-39681420 CACTGGAGCCTCCCGGGTTCAGG + Intronic
1026528212 7:71174213-71174235 CTCTGAGGCCTCCCTGACCCTGG - Intronic
1026805124 7:73424461-73424483 CTCAGAGGCCTCCAGGGCTCCGG + Intergenic
1027188346 7:75984615-75984637 CTCTGATGCCTCCCTGGCCCTGG - Intronic
1029116764 7:98241568-98241590 CTCTCAGGACACCCGGCTCCAGG + Intronic
1029732423 7:102447081-102447103 CTCTGCGGACTCCCGGGCACAGG - Exonic
1034979763 7:155468161-155468183 CCCTCAGGGCTACCGGGTCCCGG - Intergenic
1034990966 7:155548065-155548087 CTCCCAGGCCACCCTGGTCCTGG - Intergenic
1035242238 7:157539781-157539803 CTCTGGGGCCCCACAGGTCCGGG + Exonic
1035820789 8:2589451-2589473 CTCTGGGGCCTCCAGGGAGCTGG - Intergenic
1041803457 8:61824422-61824444 TCCTGAGGCCTCCCCAGTCCTGG - Intergenic
1042269503 8:66941126-66941148 CTCTGCGGCCTCCTGTGTCCTGG + Intergenic
1047497740 8:125420414-125420436 CTCAAAGGTCTCCAGGGTCCAGG + Intergenic
1049363024 8:142221568-142221590 GTCTGAGGGCTCCTGGCTCCTGG - Intronic
1049420234 8:142513205-142513227 CACTGAGGCTCCCAGGGTCCAGG - Intronic
1049597204 8:143490199-143490221 CTGGGAGGCCCCCCGGGGCCTGG + Intronic
1049630441 8:143651958-143651980 CCCTAAGGCCTCCTGCGTCCTGG + Exonic
1051171572 9:14322712-14322734 CGCTCCCGCCTCCCGGGTCCCGG - Intronic
1057470173 9:95349857-95349879 CTCTGTCCCCGCCCGGGTCCCGG + Intergenic
1058618491 9:106860785-106860807 CTCAGACACCCCCCGGGTCCCGG + Intergenic
1059277755 9:113109939-113109961 CTCTGTGACCTCCCTGGACCAGG + Intergenic
1059278496 9:113114612-113114634 CTCTGTGACCTCCCTGGACCAGG - Intergenic
1060311826 9:122469441-122469463 TTCTGAGGCCTCCCCAGTCATGG + Intergenic
1060661608 9:125408206-125408228 CGCTGAAGCCCCGCGGGTCCCGG - Intergenic
1062267759 9:135695193-135695215 CTGTGAGGCCACCCCTGTCCTGG - Exonic
1062369217 9:136228588-136228610 TGCTGAGGCCTCCAGGCTCCAGG - Intronic
1062467781 9:136688721-136688743 CTCTCAGACCTCCCGGCTGCGGG - Intergenic
1062562268 9:137146846-137146868 CTCTGGTCCCTCCCGGGGCCTGG - Intronic
1062583331 9:137237759-137237781 CTCTTAGGCCTCCTGGGCCTTGG + Intergenic
1062688035 9:137826387-137826409 CTCTGAGGCCTCCTGGTGCCTGG - Intronic
1203771442 EBV:51886-51908 CTCTGAGCCCTTCCGGTCCCTGG - Intergenic
1190569836 X:51769933-51769955 CTCTGAGGCCCCACGTGTTCAGG - Intergenic
1190701062 X:52990186-52990208 CTCTGAGGCTTTCCCGGTCTTGG + Intronic
1196395868 X:115261260-115261282 CTCTGGGGCCTCAGGGGTCATGG - Intergenic
1199881058 X:151974534-151974556 CGCGAAGGGCTCCCGGGTCCCGG + Intronic
1201178239 Y:11322561-11322583 CTCGGAGGCCTCCGGGGGCGCGG - Intergenic