ID: 932776346

View in Genome Browser
Species Human (GRCh38)
Location 2:74530281-74530303
Sequence AGAGTTCTCTGAGGCCTCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 8, 3: 105, 4: 500}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932776346_932776361 24 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776361 2:74530328-74530350 GCGGTGGCGCTGGGCGCTGGGGG 0: 1
1: 0
2: 3
3: 43
4: 419
932776346_932776355 8 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776346_932776357 15 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776357 2:74530319-74530341 GCGTGGCTGGCGGTGGCGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 250
932776346_932776356 14 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776356 2:74530318-74530340 CGCGTGGCTGGCGGTGGCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236
932776346_932776358 21 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776358 2:74530325-74530347 CTGGCGGTGGCGCTGGGCGCTGG 0: 1
1: 0
2: 1
3: 45
4: 424
932776346_932776351 2 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776351 2:74530306-74530328 AACCCGTTCGCGCGCGTGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 9
932776346_932776360 23 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776360 2:74530327-74530349 GGCGGTGGCGCTGGGCGCTGGGG 0: 1
1: 0
2: 5
3: 73
4: 763
932776346_932776362 25 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776362 2:74530329-74530351 CGGTGGCGCTGGGCGCTGGGGGG 0: 1
1: 0
2: 1
3: 34
4: 372
932776346_932776350 -2 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776350 2:74530302-74530324 CTGGAACCCGTTCGCGCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 16
932776346_932776363 26 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776363 2:74530330-74530352 GGTGGCGCTGGGCGCTGGGGGGG 0: 1
1: 0
2: 1
3: 97
4: 813
932776346_932776359 22 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776359 2:74530326-74530348 TGGCGGTGGCGCTGGGCGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 271
932776346_932776354 5 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776354 2:74530309-74530331 CCGTTCGCGCGCGTGGCTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932776346 Original CRISPR AGAGTTCTCTGAGGCCTCCC GGG (reversed) Exonic