ID: 932776347

View in Genome Browser
Species Human (GRCh38)
Location 2:74530282-74530304
Sequence CAGAGTTCTCTGAGGCCTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 280}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932776347_932776362 24 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776362 2:74530329-74530351 CGGTGGCGCTGGGCGCTGGGGGG 0: 1
1: 0
2: 1
3: 34
4: 372
932776347_932776358 20 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776358 2:74530325-74530347 CTGGCGGTGGCGCTGGGCGCTGG 0: 1
1: 0
2: 1
3: 45
4: 424
932776347_932776356 13 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776356 2:74530318-74530340 CGCGTGGCTGGCGGTGGCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236
932776347_932776361 23 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776361 2:74530328-74530350 GCGGTGGCGCTGGGCGCTGGGGG 0: 1
1: 0
2: 3
3: 43
4: 419
932776347_932776354 4 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776354 2:74530309-74530331 CCGTTCGCGCGCGTGGCTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 37
932776347_932776360 22 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776360 2:74530327-74530349 GGCGGTGGCGCTGGGCGCTGGGG 0: 1
1: 0
2: 5
3: 73
4: 763
932776347_932776363 25 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776363 2:74530330-74530352 GGTGGCGCTGGGCGCTGGGGGGG 0: 1
1: 0
2: 1
3: 97
4: 813
932776347_932776351 1 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776351 2:74530306-74530328 AACCCGTTCGCGCGCGTGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 9
932776347_932776359 21 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776359 2:74530326-74530348 TGGCGGTGGCGCTGGGCGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 271
932776347_932776350 -3 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776350 2:74530302-74530324 CTGGAACCCGTTCGCGCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 16
932776347_932776357 14 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776357 2:74530319-74530341 GCGTGGCTGGCGGTGGCGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 250
932776347_932776355 7 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932776347 Original CRISPR CAGAGTTCTCTGAGGCCTCC CGG (reversed) Exonic
900764484 1:4494751-4494773 CAGAGGGCTCTGTGGCCACCTGG - Intergenic
900828346 1:4945036-4945058 GAGAGTTCTCAGAGGCTGCCAGG - Intergenic
900871972 1:5310793-5310815 CAGAGTGCTATGGGGACTCCTGG - Intergenic
901425575 1:9180754-9180776 CAGCTTTCTCTTGGGCCTCCAGG - Intergenic
902380397 1:16049812-16049834 CAGGGGTCTCTGTGGCATCCTGG + Exonic
903135797 1:21308490-21308512 CAGAGCTCCCTCAGGCCTCCTGG - Intronic
903339580 1:22645226-22645248 CAAAGCTCAATGAGGCCTCCAGG + Intronic
904276769 1:29390023-29390045 CAGGCTTCTCTGAGGACTCCTGG + Intergenic
904383040 1:30124385-30124407 CAGAGCTGTCAGAGGCCTGCAGG + Intergenic
904434434 1:30485098-30485120 CAGAGCTCTCTGTGGCCAGCTGG + Intergenic
905457115 1:38095950-38095972 CAGAGGTGTCTGAGGGCTCTTGG + Intergenic
906469190 1:46113366-46113388 CATAGTTCACTGCAGCCTCCTGG + Intronic
910101965 1:83586870-83586892 GTAAGTTCTTTGAGGCCTCCCGG - Intergenic
910765437 1:90777679-90777701 CAGAGATGTCTGAGGCATCTTGG - Intergenic
910820191 1:91337625-91337647 CCAAGTTACCTGAGGCCTCCCGG - Intronic
912234540 1:107835276-107835298 CATAGTGCTCCTAGGCCTCCAGG - Intronic
914824223 1:151129773-151129795 CTGATTTCTCAGAGGCATCCTGG - Intergenic
916066233 1:161138018-161138040 CTGAGTTCTGTGAGTCCTGCAGG - Intergenic
916070887 1:161169123-161169145 CAGTGTTCTCAGAGGCCAGCCGG + Exonic
916686598 1:167152706-167152728 CAGAGTGCTCAGAGGCCTCAAGG - Intergenic
916923485 1:169493479-169493501 CACACTTCTCTGATGCCTCTTGG + Intergenic
917498840 1:175567409-175567431 CACAGTCCTCCGTGGCCTCCTGG - Intronic
918649890 1:186948899-186948921 AAGAGGACTCTGAGGACTCCTGG + Intronic
921371891 1:214432120-214432142 CATAGCTCACTGAAGCCTCCTGG - Intronic
922763760 1:228147352-228147374 CAGGGCTCTCTGAGGCCTACAGG - Intronic
924856697 1:247881417-247881439 AAAAGCTCCCTGAGGCCTCCTGG + Intergenic
1062915869 10:1240907-1240929 CTCAGTTCCCTGAGGCCTGCGGG - Intronic
1063580935 10:7306215-7306237 CACAGTTCACTGAAGCCTGCCGG - Intronic
1063804676 10:9624828-9624850 CAGAGTTTACTGAGGGGTCCAGG - Intergenic
1064148490 10:12843618-12843640 GAGTGTTCACTGAGGCCTCCTGG + Intergenic
1065361619 10:24894560-24894582 CAGAGTTCTGTGAAGGCACCCGG + Intronic
1066622588 10:37374200-37374222 TAGAGTTCTCTCCAGCCTCCTGG + Intronic
1067038457 10:42935553-42935575 CAGAGGCCTGTGAGGTCTCCTGG + Intergenic
1067835969 10:49641993-49642015 CAGGGCTCCCCGAGGCCTCCTGG + Intronic
1068121324 10:52784813-52784835 CAGAGTTCTCTGGGCCCTGCTGG - Intergenic
1068654418 10:59560013-59560035 CAGGGTTCCGAGAGGCCTCCTGG + Intergenic
1068733971 10:60391178-60391200 CGCACTTCTCTGAGGCCTCACGG + Intronic
1069610104 10:69767253-69767275 CAGATTTCTCTTAGGTTTCCTGG - Intergenic
1072609934 10:97011268-97011290 CAGAGCTCTGTGTGACCTCCTGG - Intronic
1072909477 10:99487010-99487032 CAGCTTTCACTCAGGCCTCCTGG + Intergenic
1073369673 10:102976334-102976356 CAGGGTTCTCTGAACCCTCAAGG + Intronic
1074002979 10:109390844-109390866 CAGGCTTCTCTGAGGCCCCAGGG - Intergenic
1074128243 10:110548143-110548165 CATAGCTCACTGAAGCCTCCTGG + Intergenic
1074312059 10:112330420-112330442 CAGAGTTCTCTGATTCCAGCAGG + Intergenic
1075742889 10:124706499-124706521 CAAAGCTCTGTGAGGCGTCCCGG - Intronic
1076030221 10:127151109-127151131 AAGAGTTTTCTGAGGTCTGCAGG - Intronic
1076326072 10:129624040-129624062 CTGAGTTCGATGGGGCCTCCAGG + Intronic
1077019221 11:410147-410169 CAGAGTTCTCGGAGGCCAGCAGG + Intronic
1077335523 11:2002106-2002128 CAGGGTTCTCGGAGGTCTTCTGG - Intergenic
1078205872 11:9228926-9228948 CAGAGTTCTATGAGCCATTCTGG + Intronic
1078275150 11:9837266-9837288 TAGACTTCTCTGAGGCCTTCAGG + Intronic
1078275340 11:9839640-9839662 TAGACTTCTCGGAGGCCTTCAGG + Exonic
1078338341 11:10481554-10481576 CTGAGTCCTGTGAGTCCTCCTGG - Intronic
1081345998 11:41987011-41987033 CAGAAGACTCTGAGGCATCCAGG - Intergenic
1083490610 11:63012590-63012612 CAGAGTGCTCTGAGGCCCAGGGG - Intronic
1083640659 11:64143537-64143559 CTGGGTCCCCTGAGGCCTCCTGG - Intronic
1085052150 11:73385317-73385339 CCTCTTTCTCTGAGGCCTCCAGG + Intronic
1089670367 11:120052616-120052638 CAGGGTTCCCTGAGGACTCCTGG - Intergenic
1090460591 11:126888271-126888293 CAGAGCTCTCTGGGGCCTAGAGG + Intronic
1202818507 11_KI270721v1_random:57288-57310 CAGGGTTCTCGGAGGTCTTCTGG - Intergenic
1091825651 12:3510771-3510793 CAGAGTTTTCAGAGGTCTTCAGG + Intronic
1092884827 12:12915840-12915862 CAGTGGTCTCTGAAGCCTGCAGG + Exonic
1092933943 12:13342594-13342616 CAGACTTCTCTGCAGCCTCCAGG + Intergenic
1096192863 12:49631561-49631583 CAGGGTTTTCTGAGGCCCCAGGG - Intronic
1096638354 12:52975490-52975512 CTGCATTCTCTGAGGCCCCCAGG + Intergenic
1097345214 12:58483823-58483845 CAGAATTCTGTGAGGGCTCAGGG - Intergenic
1097866079 12:64560110-64560132 CAGAGCCCTCTGAACCCTCCAGG - Intergenic
1099043479 12:77685650-77685672 TACAGTTCTCTGAGGCTTGCTGG - Intergenic
1099176454 12:79428346-79428368 CAGAGTTCAGTGTGGCCTCCAGG - Intronic
1099627765 12:85097250-85097272 CTAAGTTCCCTGGGGCCTCCCGG - Intronic
1101351171 12:103930794-103930816 CCGAGGTCGCTGAGACCTCCGGG - Intronic
1101804191 12:108049047-108049069 CTGAGTTCCCTGAGGCCTCGAGG + Intergenic
1101985091 12:109439755-109439777 AAGAGCTGGCTGAGGCCTCCTGG + Exonic
1105572821 13:21620195-21620217 CAGGGCTCTCTGAGGGCTCGAGG + Intergenic
1106006881 13:25778956-25778978 CAGAGCTCTCTGAGACATTCTGG - Intronic
1107787212 13:43969169-43969191 CAGAGTATTCTGGGGCCTCCGGG - Intergenic
1108942754 13:55977739-55977761 CAGAAATCTCTGCGGCCCCCAGG - Intergenic
1109236771 13:59831284-59831306 CTGAGTTCTATGAGCCCTTCCGG - Intronic
1110531408 13:76602887-76602909 CAGAGTTCCCTGAAGCCTATCGG + Intergenic
1110549671 13:76798219-76798241 CACAGTTCTCTGAGGCCATGAGG - Intergenic
1111899954 13:94188463-94188485 CAGAACTCTCTGAGGCATGCTGG - Intronic
1112427105 13:99312647-99312669 AAGACTTCTCTGACTCCTCCTGG - Intronic
1113099672 13:106703762-106703784 CAGAGAGCTCTGAGCCGTCCTGG - Intergenic
1113596314 13:111536665-111536687 CAGAGTTCTCAACGTCCTCCTGG - Intergenic
1113604377 13:111595030-111595052 CTGGGTTCTCTGAGTCCTCCTGG - Intronic
1114463140 14:22901105-22901127 CAGATCACTCTGAGGCCTCCTGG + Exonic
1114484003 14:23052459-23052481 CAGAGCTCGGTGAGGACTCCAGG - Exonic
1116183424 14:41565529-41565551 CTGATGTCTCTGAGGCCACCAGG - Intergenic
1116492761 14:45526140-45526162 GAGAGTTACCTAAGGCCTCCTGG - Intergenic
1117190827 14:53289389-53289411 CTGAGTTCTGTGAGCCATCCTGG + Intergenic
1117657183 14:57967509-57967531 AAGAGTTCTCTGAGGCCTAATGG - Intronic
1118632824 14:67722067-67722089 CAGAGCACTCTCAGCCCTCCAGG + Intronic
1118799994 14:69180996-69181018 CATAGTTCACTGCAGCCTCCTGG + Intergenic
1119721892 14:76897576-76897598 CAGAGGACCCTGCGGCCTCCCGG + Intergenic
1120504607 14:85339473-85339495 CAGAGTTCTATGTGTCCTCCAGG - Intergenic
1121243823 14:92448820-92448842 GAAAGTTCTCTCATGCCTCCAGG + Intronic
1122183271 14:99971237-99971259 CAGAGCTCACAGAGGCCACCGGG - Intergenic
1122922500 14:104885797-104885819 CTGAGTTCTGTGAGGCTGCCTGG + Intronic
1123711347 15:22990004-22990026 CAGAGGACTCTGATGCCTCCTGG - Intronic
1124142109 15:27086825-27086847 CTGGCTTCTCTGAGGCCTGCTGG + Intronic
1124175726 15:27422276-27422298 CTGAGTGTTCTGAGGCATCCAGG + Intronic
1127393266 15:58523513-58523535 CAGAGTTCTCTGGGGCATGAAGG + Intronic
1128304566 15:66589503-66589525 CTGAGTTCTGTGAGGCTTGCAGG + Intronic
1128791499 15:70437930-70437952 CAGATTTCCTTCAGGCCTCCTGG + Intergenic
1128921257 15:71612158-71612180 CAAAGGTCTCCCAGGCCTCCTGG - Intronic
1128989625 15:72248654-72248676 TAGAGTTCTCTCAGTCTTCCTGG - Intronic
1129187998 15:73922380-73922402 CATAGTTGTCTGGGGCCTTCTGG - Intergenic
1130146811 15:81280741-81280763 CAGAGGCATCTGAGGCCTCAGGG - Intronic
1130298626 15:82664188-82664210 AGGAGATCTCTGAGGCCTCATGG - Intronic
1130375758 15:83327307-83327329 CAGCCTTCTCTCAGGCCCCCAGG - Intergenic
1131055305 15:89371353-89371375 CTGAGTCCTAGGAGGCCTCCTGG - Intergenic
1132625030 16:887596-887618 CAGAGTTCTGCGGGGCCTCCAGG - Intronic
1134108408 16:11499693-11499715 CAGGGGTCTCTGATGCCCCCAGG + Intronic
1135173095 16:20203861-20203883 CTGGGTTCTCTCAGGACTCCAGG + Intergenic
1136066364 16:27761557-27761579 CCGAGTACTCTGACGACTCCCGG + Exonic
1136190167 16:28610666-28610688 CAATGTTCTCTGAGGTCCCCAGG - Intronic
1136743290 16:32559471-32559493 CAGAGTCCTCTGAGGCCTATAGG + Intergenic
1138146444 16:54616483-54616505 GAGAGTTCTATGCCGCCTCCCGG - Intergenic
1138445181 16:57059044-57059066 CTTACTTCACTGAGGCCTCCCGG - Exonic
1138934728 16:61705253-61705275 CAGTGTTTACTGAAGCCTCCTGG - Intronic
1138954834 16:61958580-61958602 CAAATTTCTCTAAAGCCTCCTGG + Intronic
1139959448 16:70709367-70709389 CAGAGATCACTGGGGCCTTCTGG + Intronic
1140456207 16:75107092-75107114 CAGATGAATCTGAGGCCTCCAGG + Intronic
1141204552 16:81923477-81923499 CACGGTTCTCTGAGGCTTTCAGG - Exonic
1142430019 16:90021060-90021082 CAGACTTCACAGAGGCCTCAGGG + Intronic
1203026309 16_KI270728v1_random:515758-515780 CAGAGTCCTCTGAGGCCTATAGG - Intergenic
1203045412 16_KI270728v1_random:818673-818695 CAGAGTCCTCTGAGGCCTATAGG + Intergenic
1142997720 17:3770780-3770802 CAGAGGGCTCTGAGTCCACCAGG - Intronic
1143121544 17:4610783-4610805 CTGTGCTCTCTGAGGCATCCGGG + Intergenic
1143653643 17:8280093-8280115 CTGAGTTCTGTGAGTCCTTCTGG - Intergenic
1144511166 17:15878085-15878107 TAAAGCGCTCTGAGGCCTCCAGG - Intergenic
1145122604 17:20273978-20274000 TAAAGCTCTCTGAGGCCTCCAGG - Intronic
1145175325 17:20695772-20695794 TAAAGTGCTCTGAGGCTTCCAGG - Intergenic
1145900194 17:28485565-28485587 CAGTGTTCTGAGAGGCCCCCTGG - Intronic
1145900302 17:28486638-28486660 CAGTGTTCTGAGAGGCCCCCTGG + Intronic
1146685995 17:34841982-34842004 CAAGGGTCTCTCAGGCCTCCAGG + Intergenic
1151118030 17:71760506-71760528 CTGTGTTCTCTGGCGCCTCCTGG + Intergenic
1151621427 17:75247786-75247808 TAGAGTTCTCAGAGGGCCCCTGG + Intronic
1152113891 17:78372970-78372992 CAGTGAGCTCTGGGGCCTCCCGG - Intergenic
1152129286 17:78466300-78466322 CAGAGGACCCTGAGGCCTTCCGG - Intronic
1152181193 17:78822813-78822835 CAGAGTCGCCTAAGGCCTCCAGG + Intronic
1152545421 17:80997909-80997931 CCGAGTCCTCCGGGGCCTCCAGG + Intronic
1154316879 18:13311302-13311324 CAGAGCCCACTCAGGCCTCCTGG + Intronic
1157503509 18:48208348-48208370 CAGGGGTCTCTGTGGTCTCCAGG - Intronic
1157688575 18:49662562-49662584 AAGAGTTCTCTACGGCCTACAGG - Intergenic
1158573376 18:58615356-58615378 CACAGTTCTATGGGGCCTCCTGG - Intronic
1160522063 18:79513437-79513459 CAGAGTCCTCAGAAGCCTCGGGG - Intronic
1161261586 19:3340746-3340768 CTGAGTTCTCTGAAACCTTCCGG - Intergenic
1161292197 19:3500547-3500569 CAGAGCTCGGTGAGGCGTCCCGG - Exonic
1161533488 19:4804266-4804288 CAGAGCTCTCTGCAGCCCCCAGG - Intergenic
1163251780 19:16130083-16130105 CAGGGTTCTCTGAGGCCTCCAGG + Intronic
1163326606 19:16607599-16607621 CCGGGTTCTCTCAGGGCTCCGGG - Intronic
1163559898 19:18012875-18012897 CAGTGTTCTCTGAGGCTTAATGG + Intronic
1167397949 19:49243883-49243905 CCAAGTTCTCTGAGGCTTCTTGG + Intergenic
1167854536 19:52226978-52227000 CTGATTACTCTGAGACCTCCTGG - Exonic
925009485 2:471410-471432 CAGAAAGCTCTGATGCCTCCCGG + Intergenic
925306832 2:2853519-2853541 CAGAGTTCTCCTAAGCCACCTGG + Intergenic
925734122 2:6945480-6945502 CAGTCTTCTCTGAGCCTTCCTGG + Intronic
925903230 2:8523396-8523418 CAGCGTCCTCTGAGACCACCTGG + Intergenic
928197278 2:29224949-29224971 CTGAGTTCTCTGTGACCTGCAGG + Intronic
930275737 2:49309138-49309160 TAGAGTTCTCTGAGCTCTCCAGG - Intergenic
930995746 2:57715600-57715622 CACAGGTCTCAGAGGCCACCTGG - Intergenic
931450877 2:62366681-62366703 CACAGTTTTCTGAGGCTTCTGGG + Intergenic
932335326 2:70927870-70927892 CAGGGTCCTGTGTGGCCTCCTGG - Intronic
932776347 2:74530282-74530304 CAGAGTTCTCTGAGGCCTCCCGG - Exonic
933996698 2:87675485-87675507 CCTAGATCCCTGAGGCCTCCTGG + Intergenic
935634554 2:105240073-105240095 AAGCCTGCTCTGAGGCCTCCTGG + Intergenic
936297155 2:111275425-111275447 CCTAGATCCCTGAGGCCTCCTGG - Intergenic
937060626 2:118977967-118977989 CCTAGTTCCCTCAGGCCTCCTGG - Intronic
937160874 2:119759984-119760006 CATTGTTCTCTCAGGACTCCTGG + Exonic
939610014 2:144298675-144298697 CTGAGTTTTCTGAGCCCACCAGG + Intronic
940712560 2:157179922-157179944 CAGACTTCTCTCAGCCATCCTGG + Intergenic
942179160 2:173363351-173363373 CAGAATTCTCTGAGGGCTGGCGG - Exonic
942247655 2:174022748-174022770 CATAGTTCACTGCAGCCTCCAGG - Intergenic
946683570 2:222243861-222243883 CAGCCTTCTCTGTTGCCTCCAGG - Intronic
947058062 2:226130320-226130342 GAGGGTTTTCAGAGGCCTCCTGG - Intergenic
948829361 2:240590567-240590589 AAGAGTTCTCTGCGACATCCAGG + Intronic
948829364 2:240590597-240590619 TAGAGTTCTCTGCGACATCCAGG + Intronic
948829367 2:240590627-240590649 TAGAGTTCTCTGCGACATCCAGG + Intronic
948829370 2:240590657-240590679 TAGAGTTCTCTGCGACATCCAGG + Intronic
1169033703 20:2432722-2432744 CAGGATTAACTGAGGCCTCCTGG - Exonic
1169447258 20:5682771-5682793 CATAGTTCACTGCAGCCTCCTGG + Intergenic
1170986704 20:21265794-21265816 AAGAATTCTCTGAAGACTCCAGG + Intergenic
1171413287 20:24960574-24960596 CAGAGTCCTCTGGGGCGCCCAGG - Intergenic
1173554260 20:43954429-43954451 CAGTGGACTCTGAGGCCTGCAGG + Intronic
1174299518 20:49571300-49571322 CAGGGTCCTTTGAGTCCTCCCGG - Intergenic
1175345814 20:58273937-58273959 CACAGTTCACAGTGGCCTCCTGG - Intergenic
1176149294 20:63581221-63581243 CAGATATCCCTGAGGTCTCCTGG + Intergenic
1178902244 21:36606833-36606855 CAGGGCTCTCTCTGGCCTCCAGG + Intergenic
1180102670 21:45596543-45596565 GGGAGTGCTCTGAGGCCTCTGGG + Intergenic
1180597516 22:16988373-16988395 CAGGGCACTATGAGGCCTCCAGG - Intronic
1180800978 22:18631780-18631802 AAGAGATCTCTGAGGTCCCCAGG - Intergenic
1180852210 22:19027337-19027359 AAGAGATCTCTGAGGTCCCCAGG - Intergenic
1181220740 22:21363482-21363504 AAGAGATCTCTGAGGTCCCCAGG + Intergenic
1183351732 22:37338319-37338341 CCGAGTTCTTTGGCGCCTCCGGG + Intergenic
1183392514 22:37553616-37553638 CAGGGTTCTCAGAAGACTCCTGG - Intergenic
1184472648 22:44704433-44704455 CAGAGTTCAGGGAGGCCTCAGGG + Intronic
952414889 3:33081528-33081550 GAGAGTTCTCTGGGCTCTCCTGG - Intronic
954581863 3:51707286-51707308 CAGCGTTCCCTGAGAGCTCCGGG + Intronic
956380944 3:68663812-68663834 CAGAGCTCTCAGAGACCACCAGG + Intergenic
960713949 3:120557871-120557893 CAGAGCCCTCTGTGGGCTCCAGG + Intergenic
961618737 3:128206272-128206294 TAGAATTCTCCTAGGCCTCCAGG + Intronic
962265914 3:133944207-133944229 GAGAGTTCCCAGGGGCCTCCGGG - Intronic
962847065 3:139282186-139282208 CAGAATTCTCAGAGGTCACCTGG + Intronic
964903739 3:161692836-161692858 CTGAGTTCTGTGAGCCATCCTGG + Intergenic
966020557 3:175203530-175203552 CAGAGTTCTATGAGTCTTCTTGG + Intronic
966168134 3:177044926-177044948 CAGAATTCTCTCAGGCTTCTTGG - Intronic
967986105 3:195096325-195096347 CACAGCACTCAGAGGCCTCCAGG + Intronic
967992314 3:195140557-195140579 GTGAGTTTTCTGAGGCCTCCTGG - Intronic
968046107 3:195624648-195624670 CTGAATTCTCTTAGGCCACCTGG + Intergenic
968179250 3:196579019-196579041 CAGAACTCACTGATGCCTCCAGG - Intronic
968308547 3:197665439-197665461 CTGAATTCTCTTAGGCCACCTGG - Intergenic
969304372 4:6317422-6317444 CAGAGGTCCCTGGTGCCTCCAGG + Intergenic
969435406 4:7186375-7186397 CAGCGTCCTCTGAGGCATCAGGG - Intergenic
969518783 4:7663810-7663832 CAGAGCTTCCTGAGGCCTCCAGG + Intronic
971215109 4:24655424-24655446 CACAGTTCCCTGATGCTTCCAGG + Intergenic
973705069 4:53573052-53573074 CAGATTTCTCTGAGGCTTATGGG - Intronic
974884734 4:67804648-67804670 CAGAGTTATCTATGGCATCCTGG + Intergenic
976731633 4:88267682-88267704 CAGATTTCTCTGGTGCCTGCTGG - Intronic
976923589 4:90468238-90468260 CAGAGTGATATGAGTCCTCCCGG - Exonic
979671338 4:123363248-123363270 CAGCTTTCTCTGCAGCCTCCGGG - Intergenic
980739161 4:136928681-136928703 CACAGTTCACTAAGGCCTTCAGG + Intergenic
985269973 4:188184408-188184430 GAGAGTTCTCTGACCCCTCGCGG - Intergenic
986015972 5:3757425-3757447 AAGAGTTCTCTGATGATTCCTGG + Intergenic
986024311 5:3835997-3836019 CAGGGTTATCTGAGCCCTCAGGG - Intergenic
986274626 5:6262940-6262962 CCGAGTCCTGTGAGTCCTCCTGG + Intergenic
987151019 5:15040168-15040190 CAGAATTCTCTGCAGTCTCCTGG + Intergenic
992737903 5:79742259-79742281 CATAGCTCGCTGAAGCCTCCTGG + Intronic
995430486 5:112069616-112069638 CAAAGTTCTCTGGGACCTCAGGG + Intergenic
997283223 5:132661474-132661496 CACAGTTCTCATCGGCCTCCTGG - Intergenic
998098931 5:139415738-139415760 CTGACTTCACAGAGGCCTCCTGG - Intronic
999763075 5:154717739-154717761 CAGGGTTCAATTAGGCCTCCTGG - Intronic
1001569002 5:172718057-172718079 CAGAGGGCTCTGAGGCTTCTGGG - Intergenic
1001639784 5:173236192-173236214 AGGATTTCTCTGAGGCCTCTGGG + Intergenic
1001745614 5:174090147-174090169 CTGAGTGCTGTGAGTCCTCCTGG - Intronic
1002504433 5:179669169-179669191 CAGAGTCCCCTGAAGCATCCTGG - Intergenic
1002573798 5:180160256-180160278 CAGGGGTCCCTGAGGCCTCCAGG + Intronic
1002904311 6:1436502-1436524 CAGACTTCTCTGCACCCTCCGGG - Intergenic
1003396380 6:5756428-5756450 GTAAGTTTTCTGAGGCCTCCCGG - Intronic
1003540802 6:7016536-7016558 ATGAGTTATCTGGGGCCTCCAGG + Intergenic
1004149830 6:13105697-13105719 CTGAGTTCTGTGAGTCCTTCTGG - Intronic
1005532628 6:26722757-26722779 CCGCCTTCTCCGAGGCCTCCAGG - Intergenic
1005535776 6:26754846-26754868 CCGCCTTCTCCGAGGCCTCCAGG + Intergenic
1005538167 6:26778908-26778930 CCGCCTTCTCCGAGGCCTCCAGG + Intergenic
1006211552 6:32400033-32400055 CTGAGTTCTCTGAGACCCACTGG - Intronic
1006827709 6:36948346-36948368 CACAGTTCTCAGATGCCCCCCGG - Intronic
1007107308 6:39292633-39292655 CAGAATTTCCTGATGCCTCCAGG + Intergenic
1008588032 6:52966605-52966627 CAGGGGTCTCTGGGGCCTCAGGG + Intergenic
1009006807 6:57798494-57798516 CCGCCTTCTCCGAGGCCTCCAGG + Intergenic
1009009020 6:57821257-57821279 CCGCCTTCTCCGAGGCCTCCAGG + Intergenic
1010268118 6:73890714-73890736 GTGAGTTTCCTGAGGCCTCCCGG + Intergenic
1010770107 6:79818159-79818181 CAGACTTCACTGAAGTCTCCTGG - Intergenic
1010772224 6:79845005-79845027 CAGAGTTTGCTGAGGGCTCTGGG + Intergenic
1011088563 6:83570491-83570513 CAAAGTTCTCTGACGTGTCCTGG - Intronic
1011465743 6:87655258-87655280 CACAGTTCCCTCAGACCTCCTGG + Intronic
1011806818 6:91081339-91081361 CTGACTTCTCTGAGTCCTGCTGG - Intergenic
1016729842 6:147417522-147417544 CAGGGACCTCTGAGGTCTCCGGG + Intergenic
1017171134 6:151455863-151455885 CAGAGGTCCCTGCGGCCTTCCGG + Intronic
1018103184 6:160459237-160459259 CAGAGGGCTCTGGGGCCTCAAGG - Intergenic
1018811460 6:167301141-167301163 CAGGCTTCTCTGTGGCTTCCAGG + Intronic
1019035020 6:169047439-169047461 CAGTGTTCTCTGGGGGCTCAGGG + Intergenic
1020790231 7:12618101-12618123 CAGCATTCCCTGAGGCCTCTAGG + Intronic
1022498699 7:30869129-30869151 CAGAATTCTCTGAGGGCCCAGGG + Intronic
1022840912 7:34163158-34163180 CAGAGAGCTAAGAGGCCTCCTGG + Intergenic
1023512505 7:40968615-40968637 CAAAGTTCTCCGTGGCCTACAGG + Intergenic
1023761240 7:43467262-43467284 CAGAGTGCTCTGGGGGCGCCAGG + Intronic
1024636605 7:51295793-51295815 CAGACTTCTGTGAGGCTGCCAGG - Intronic
1027771944 7:82418080-82418102 GTAAGTTTTCTGAGGCCTCCTGG - Intronic
1028993843 7:97077985-97078007 CTGAGTTCTGTGAGCCTTCCTGG + Intergenic
1029003591 7:97183324-97183346 CTGAGTTCTCTGAGGTGCCCAGG - Intergenic
1029161620 7:98556508-98556530 CAGAGCTCTCTCTGGCTTCCTGG + Intergenic
1030509523 7:110467462-110467484 CTGAGTTTTCTGAGGACTCCTGG - Intergenic
1032079067 7:128849675-128849697 CCCACTTCTCTGAGGGCTCCTGG + Intronic
1034902032 7:154913918-154913940 GGCAGGTCTCTGAGGCCTCCCGG + Intergenic
1035206255 7:157295642-157295664 CAGAGCTCTCTGAGGGCTCCGGG - Intergenic
1035550316 8:518224-518246 CAGAGTTCTTAGGTGCCTCCTGG - Intronic
1036959524 8:13228673-13228695 CATAGTTCACTGCAGCCTCCTGG - Intronic
1037700129 8:21266469-21266491 CACAGGTCTCTGAGGCTCCCAGG + Intergenic
1039001092 8:32980412-32980434 AAGAGTTCTGTGAGTTCTCCCGG - Intergenic
1039100663 8:33938532-33938554 CAGAGTCCTCTGGGGTCTCTGGG + Intergenic
1039813641 8:41072481-41072503 TAGATTTCTCAGAGGCCTCCTGG + Intergenic
1040344801 8:46481142-46481164 CAGAGCTCACTGAGGCCTATAGG - Intergenic
1040912493 8:52533790-52533812 CAGAATACTCTGATGCATCCAGG - Intergenic
1041084925 8:54247873-54247895 CTGAGTCATCTGGGGCCTCCTGG - Intergenic
1042839774 8:73111966-73111988 CAGATTTCACTGAGCTCTCCTGG + Intronic
1043624906 8:82244276-82244298 CAGGGTTCTCTGGGGCCTTGGGG + Intergenic
1044964678 8:97563376-97563398 CAGACTTCTCTCAGGCCTCTGGG - Intergenic
1046942507 8:119944553-119944575 CAAAGTTGTGTGAGGCCTCAAGG - Intronic
1046942572 8:119945093-119945115 CAAAGTTGTGTGAGGCCTCAAGG - Intronic
1048852550 8:138658713-138658735 CTGAGTTCTGTGAGTCCTTCTGG + Intronic
1049433654 8:142576513-142576535 CAGCCTTCTCTGAAGCCTGCTGG + Intergenic
1049983374 9:925184-925206 CAGTGTTCTCAGATGGCTCCCGG + Intronic
1051523120 9:18012640-18012662 CAGACATTTCTGAGGGCTCCAGG - Intergenic
1052909701 9:33869522-33869544 CTGCAATCTCTGAGGCCTCCCGG + Intronic
1053437119 9:38083234-38083256 CAGAGTCCTCTGAGGCTGCTGGG + Intergenic
1053452358 9:38203629-38203651 CAGGGTTCTCTGAGACCATCTGG - Intergenic
1054790197 9:69249526-69249548 CAGATGCCTCTGAAGCCTCCTGG + Intronic
1055352358 9:75402699-75402721 CAGAATTCTCTGAGGGTTCGGGG + Intergenic
1055468249 9:76586672-76586694 CAGAGCTCTCTTGGGCCCCCAGG + Intergenic
1056104812 9:83336707-83336729 AAGGGTTCTCTGGGGCCTCTTGG - Intronic
1057189994 9:93081785-93081807 CATGGTGGTCTGAGGCCTCCAGG + Intronic
1059786438 9:117591338-117591360 CAGATTTCCCTGAACCCTCCAGG - Intergenic
1060024546 9:120160227-120160249 CACAGCTCTCTGGGCCCTCCTGG - Intergenic
1060748045 9:126150674-126150696 CAGAGAACTCTGAGGCCCCAGGG + Intergenic
1061242426 9:129382415-129382437 CAGAGCTCTGTGGGGCCTCTGGG + Intergenic
1061324213 9:129852961-129852983 CAGGCTTCCCTGAGCCCTCCTGG - Intronic
1061377166 9:130233392-130233414 CAGAGTTCTCTGAGGTCCCCAGG - Exonic
1062392878 9:136340947-136340969 CAGGCTTCTCTGAGGCTGCCGGG - Exonic
1186443194 X:9603789-9603811 CAGCTACCTCTGAGGCCTCCAGG + Intronic
1186743994 X:12546940-12546962 CATAGCTCACTGAAGCCTCCTGG - Intronic
1187668535 X:21644130-21644152 CAGAGTGCTTTAAGGCTTCCGGG - Intronic
1188165718 X:26860621-26860643 CAGATTTCTCTAAAACCTCCAGG + Intergenic
1189757713 X:44287708-44287730 CACAGCTCTCTGATGCCTCCAGG - Intronic
1190989924 X:55536407-55536429 CAGATTTCTCTGAGGGCTGCGGG + Intergenic
1196600856 X:117600403-117600425 CTGAGTTCTCTCAGGGCCCCAGG + Intergenic
1200061663 X:153486457-153486479 CAGAGACCACTGCGGCCTCCTGG - Intronic
1200239805 X:154487497-154487519 CCCAGTTCCCTGAGGCCTCTGGG - Exonic