ID: 932776349

View in Genome Browser
Species Human (GRCh38)
Location 2:74530290-74530312
Sequence ACGGGTTCCAGAGTTCTCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 148}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932776349_932776361 15 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776361 2:74530328-74530350 GCGGTGGCGCTGGGCGCTGGGGG 0: 1
1: 0
2: 3
3: 43
4: 419
932776349_932776360 14 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776360 2:74530327-74530349 GGCGGTGGCGCTGGGCGCTGGGG 0: 1
1: 0
2: 5
3: 73
4: 763
932776349_932776359 13 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776359 2:74530326-74530348 TGGCGGTGGCGCTGGGCGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 271
932776349_932776363 17 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776363 2:74530330-74530352 GGTGGCGCTGGGCGCTGGGGGGG 0: 1
1: 0
2: 1
3: 97
4: 813
932776349_932776356 5 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776356 2:74530318-74530340 CGCGTGGCTGGCGGTGGCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236
932776349_932776358 12 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776358 2:74530325-74530347 CTGGCGGTGGCGCTGGGCGCTGG 0: 1
1: 0
2: 1
3: 45
4: 424
932776349_932776362 16 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776362 2:74530329-74530351 CGGTGGCGCTGGGCGCTGGGGGG 0: 1
1: 0
2: 1
3: 34
4: 372
932776349_932776351 -7 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776351 2:74530306-74530328 AACCCGTTCGCGCGCGTGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 9
932776349_932776357 6 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776357 2:74530319-74530341 GCGTGGCTGGCGGTGGCGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 250
932776349_932776354 -4 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776354 2:74530309-74530331 CCGTTCGCGCGCGTGGCTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 37
932776349_932776355 -1 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932776349 Original CRISPR ACGGGTTCCAGAGTTCTCTG AGG (reversed) Exonic