ID: 932776349

View in Genome Browser
Species Human (GRCh38)
Location 2:74530290-74530312
Sequence ACGGGTTCCAGAGTTCTCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 148}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932776349_932776363 17 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776363 2:74530330-74530352 GGTGGCGCTGGGCGCTGGGGGGG 0: 1
1: 0
2: 1
3: 97
4: 813
932776349_932776356 5 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776356 2:74530318-74530340 CGCGTGGCTGGCGGTGGCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236
932776349_932776361 15 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776361 2:74530328-74530350 GCGGTGGCGCTGGGCGCTGGGGG 0: 1
1: 0
2: 3
3: 43
4: 419
932776349_932776355 -1 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776349_932776354 -4 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776354 2:74530309-74530331 CCGTTCGCGCGCGTGGCTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 37
932776349_932776359 13 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776359 2:74530326-74530348 TGGCGGTGGCGCTGGGCGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 271
932776349_932776362 16 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776362 2:74530329-74530351 CGGTGGCGCTGGGCGCTGGGGGG 0: 1
1: 0
2: 1
3: 34
4: 372
932776349_932776358 12 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776358 2:74530325-74530347 CTGGCGGTGGCGCTGGGCGCTGG 0: 1
1: 0
2: 1
3: 45
4: 424
932776349_932776351 -7 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776351 2:74530306-74530328 AACCCGTTCGCGCGCGTGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 9
932776349_932776360 14 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776360 2:74530327-74530349 GGCGGTGGCGCTGGGCGCTGGGG 0: 1
1: 0
2: 5
3: 73
4: 763
932776349_932776357 6 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776357 2:74530319-74530341 GCGTGGCTGGCGGTGGCGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932776349 Original CRISPR ACGGGTTCCAGAGTTCTCTG AGG (reversed) Exonic
901705567 1:11070542-11070564 AAGAGTTCCAGAGTGCTCTGGGG + Intronic
902085699 1:13859843-13859865 ATTGGTTCCAGGATTCTCTGTGG - Intergenic
904350718 1:29903903-29903925 ACAGGCTCCAGAGTTCCTTGAGG + Intergenic
906128774 1:43443446-43443468 AGGGGGTCCAGAGGTCTCTGGGG - Exonic
906935998 1:50214592-50214614 ACTGGTTCTAAAGTACTCTGGGG - Intergenic
909610977 1:77551573-77551595 AAGGGTCCCAGAGCTCTCAGTGG - Intronic
909706805 1:78594980-78595002 ACTGGTTACAGAATTTTCTGGGG - Intergenic
910147946 1:84104799-84104821 AAGGGTTCCAGAGGGCTCTCTGG - Intronic
911325667 1:96468673-96468695 ACAGGTACCAGACTTCTCTAAGG - Intergenic
916304459 1:163313668-163313690 AAGGGTTCCTCAGTTCTGTGGGG - Intronic
916478841 1:165196721-165196743 ACTGGTTCCAGGACTCTCTGAGG + Intergenic
920990665 1:210936278-210936300 ATGGGTTCCAGAGGTCTCAGAGG - Intronic
921147728 1:212375492-212375514 TTGGTTTCCACAGTTCTCTGGGG + Intronic
921246862 1:213252652-213252674 AAGGATTCCAAAGTTCTCTTTGG - Intronic
922763762 1:228147360-228147382 AGGGGTGCCAGGGCTCTCTGAGG - Intronic
1063559137 10:7110235-7110257 AGGGGTAACAGAGTTCTCTGGGG + Intergenic
1064901284 10:20298272-20298294 AAGTGTTTCAGAGCTCTCTGAGG + Intergenic
1070083883 10:73215711-73215733 ATGGTTTCCAGAGTTCTTTGTGG + Intronic
1072823589 10:98583293-98583315 ACTGGTTACAGAATTTTCTGGGG - Intronic
1073094844 10:100973123-100973145 CCGGGTCCCAGAGAGCTCTGGGG - Exonic
1075155494 10:119973281-119973303 GCTGGTTACAGAGTTTTCTGGGG + Intergenic
1075168336 10:120089852-120089874 AGGGGTTCAAGATTTCACTGGGG + Intergenic
1076182612 10:128422268-128422290 ACGGGTTCCAGAGTGGTCTCTGG - Intergenic
1076652849 10:132001873-132001895 ACGGGTTACAGAATTTTCTGAGG - Intergenic
1077749980 11:4956309-4956331 TCGGGTCACAGAGTTCTCTGGGG + Intronic
1080207476 11:29747337-29747359 AAGAGGTCCAGAGTTGTCTGGGG + Intergenic
1086022393 11:82247246-82247268 ACTGGTACCAGGGTTCACTGAGG - Intergenic
1087151599 11:94865053-94865075 TCTGGTGCCGGAGTTCTCTGGGG + Intronic
1087413339 11:97821040-97821062 AAGGTTGCCAGAGTTCTCAGAGG + Intergenic
1088738204 11:112745969-112745991 TCTGGTTCTGGAGTTCTCTGGGG + Intergenic
1089593053 11:119557144-119557166 ACTGGTTACAGAATTTTCTGTGG - Intergenic
1090267661 11:125363636-125363658 AGGGTCTCCAGAGTGCTCTGAGG + Intronic
1091209780 11:133846144-133846166 ACTGGTTACAGAATTTTCTGGGG - Intergenic
1094288508 12:28819695-28819717 ACTGGTTACACAGTTTTCTGGGG + Intergenic
1095386852 12:41660840-41660862 ACGATTTCCAGACTGCTCTGGGG + Intergenic
1097932182 12:65200293-65200315 ACTGGTTACAGAATTTTCTGGGG - Intronic
1098135487 12:67397423-67397445 CCTGGTTCCAGAATTGTCTGGGG + Intergenic
1098711385 12:73767255-73767277 ACTGGTTACAGAATTTTCTGGGG + Intergenic
1101411604 12:104473376-104473398 ACTGCTTCCAGAGCCCTCTGAGG - Intronic
1103456729 12:121073297-121073319 TAGGGTTCCATAGTTCTCTGAGG - Intergenic
1105825140 13:24115723-24115745 TCCGGTTCCAGATTTCTCAGTGG + Intronic
1106857472 13:33868657-33868679 ACTGGTTACAGAATTTTCTGGGG - Intronic
1108467479 13:50731196-50731218 ACTGGTTACAGAATTTTCTGGGG - Intronic
1111055489 13:82944149-82944171 ACTGATTACAGAGTTTTCTGGGG + Intergenic
1118450954 14:65901736-65901758 ACTGGTTACAGAATTTTCTGGGG - Intergenic
1121340049 14:93099765-93099787 TGGGGTTCCAGAATTCTCGGAGG - Intronic
1124955200 15:34355806-34355828 AAGGGTCCCGGAGTTCCCTGTGG - Exonic
1127891780 15:63258658-63258680 ACTGGTTACAGAATTTTCTGGGG + Intronic
1129386441 15:75198729-75198751 ACTGGTTACAGAATTTTCTGGGG + Intronic
1130312006 15:82764377-82764399 CCGGGTTACAGAATTTTCTGGGG - Intronic
1131149466 15:90037798-90037820 TCGAGATCCAGAGTTCTTTGAGG - Intronic
1136373454 16:29850255-29850277 AATTTTTCCAGAGTTCTCTGTGG + Intergenic
1140565516 16:76036934-76036956 ACTGGTTACAGAATTTTCTGGGG + Intergenic
1140592563 16:76371214-76371236 ATGAGCTCCAGAGTTCACTGAGG + Intronic
1140642040 16:76986486-76986508 CCTGGTTACAGAATTCTCTGGGG + Intergenic
1143735072 17:8905774-8905796 ACGGGGTCCAGGGCTCCCTGAGG + Intronic
1144424976 17:15133220-15133242 ACTGGTTACAGAATTTTCTGGGG + Intergenic
1145220198 17:21082255-21082277 ACTGGTTACAGAATTTTCTGGGG - Intergenic
1148746762 17:49922671-49922693 TCTGGCTCCAGAGTTCTCTGGGG - Intergenic
1150525923 17:65922615-65922637 AGATGTTGCAGAGTTCTCTGTGG - Intronic
1152492196 17:80643745-80643767 ATGGTTTCCAGAGCTTTCTGAGG - Exonic
1152608945 17:81306310-81306332 ACTGGTTCTAGAATTCTCTCAGG - Intergenic
1152995438 18:402199-402221 ACTGGTTACAGAATTTTCTGGGG + Intronic
1153624622 18:7012394-7012416 GCGGCTTCCAGAGTTGTCTCGGG - Intronic
1154123018 18:11666769-11666791 ACGGGCCCCAGAGTGCCCTGAGG - Intergenic
1155826321 18:30447718-30447740 ACGGGTTACAGAATTGTTTGGGG - Intergenic
1158679896 18:59557709-59557731 ACTGGTTACAGACTTTTCTGGGG - Intronic
1158732898 18:60045257-60045279 CAGGTTTCCAGAGTTGTCTGTGG + Intergenic
1161410368 19:4113592-4113614 ACGGGCTCCAGTGTTCCCCGAGG - Intronic
1163083870 19:14964742-14964764 AAGGGTTTAAGAGTTTTCTGTGG - Intronic
1163559896 19:18012867-18012889 TCTGTTTCCAGTGTTCTCTGAGG + Intronic
1168672162 19:58248843-58248865 ACTGGTTACAGAATTTTCTGGGG + Intronic
1168714412 19:58518627-58518649 TCAGATTCCAGAGTCCTCTGAGG - Intronic
1168719284 19:58545981-58546003 ATGGGTCCTAGAGTTCTCTAGGG + Intronic
926441775 2:12896376-12896398 AAGGGTTTCAGAGCCCTCTGTGG + Intergenic
927257339 2:21051019-21051041 ATTGGTACCAGAGTTCTTTGGGG - Intergenic
928049914 2:27980558-27980580 AAGTGTTTCACAGTTCTCTGAGG + Intronic
928069898 2:28204359-28204381 AACGGTTCTAGAATTCTCTGAGG - Intronic
931181806 2:59908996-59909018 AAGAGTTCCAGGATTCTCTGTGG + Intergenic
931790426 2:65659366-65659388 ACAGGTTCGAGAGGGCTCTGAGG + Intergenic
932776349 2:74530290-74530312 ACGGGTTCCAGAGTTCTCTGAGG - Exonic
936110455 2:109660350-109660372 ACTGGTTACAGAGTTTTCTGGGG - Intergenic
937019237 2:118635026-118635048 AGGGCTTCAAGAGCTCTCTGGGG + Intergenic
938688646 2:133765803-133765825 AAGGGATCCAGAGCTCTCAGCGG - Intergenic
940809066 2:158222508-158222530 AGGGGTTCCAGAGGTCTCAGTGG - Intronic
941541729 2:166794383-166794405 ACTGGTTACAGAATTTTCTGGGG + Intergenic
942329486 2:174807024-174807046 GTGGTTTCCAGAGTTCTCTGAGG + Intronic
942541795 2:177022489-177022511 AGGGGTTTCAGAATTATCTGGGG + Intergenic
945909020 2:215625339-215625361 TCGGATTGCAGAGTTATCTGGGG - Intergenic
947961681 2:234244026-234244048 ACTGGTTACAGAATTTTCTGGGG + Intergenic
1169234396 20:3918494-3918516 AGTGGGTCCAGAGTTGTCTGGGG + Intronic
1170011337 20:11727398-11727420 ACTGGTTCCACAGGGCTCTGAGG + Intergenic
1174867658 20:54152667-54152689 CCTGGTTCCAGAGGCCTCTGGGG + Intergenic
1175169843 20:57072461-57072483 ATGGGTTGCAGACTTGTCTGTGG - Intergenic
1176078639 20:63260692-63260714 CCGGGATCCAGAGGTGTCTGCGG - Intronic
1180961332 22:19763688-19763710 CCAGGATCCAGAGTTCCCTGGGG - Intronic
1184118615 22:42436383-42436405 AAGGGTTCCAGGGTACTCAGGGG + Intergenic
949280713 3:2343559-2343581 ACTGGTTACAGAATTTTCTGGGG - Intronic
951859751 3:27238876-27238898 ACTGGTTACAGAATTTTCTGGGG + Intronic
952662176 3:35865097-35865119 ACTGGTTACAGAATTTTCTGGGG - Intergenic
954158892 3:48705578-48705600 AGGAGTTCCAGAATTCTGTGAGG + Intronic
955661821 3:61307609-61307631 ACTGTCTCCAGAGTTCCCTGAGG - Intergenic
960963394 3:123088317-123088339 AAGTTTTCCAGGGTTCTCTGGGG + Intronic
961110304 3:124277844-124277866 AAGGGGTCCACAGTTCTATGGGG - Intronic
962251084 3:133836547-133836569 ATGGGTTCCAGAGCACTCTGGGG + Intronic
963805270 3:149715412-149715434 ACGGGTGCCAGCGCTCTGTGAGG - Intronic
963852451 3:150222245-150222267 ACGGCTTCCCAAGTCCTCTGGGG + Intergenic
967189917 3:186976119-186976141 CTGGGTCTCAGAGTTCTCTGTGG - Intronic
971230029 4:24794245-24794267 ACTGGTGCCTGAGTTCTCAGCGG + Intronic
971396766 4:26235666-26235688 AGCTGTTCCAGAGCTCTCTGGGG + Intronic
975597120 4:76058878-76058900 AGAGGTTCCAGAGCTCTGTGTGG + Intronic
975940727 4:79642255-79642277 AGGGGTTCAAGACTTCACTGGGG + Intergenic
976778724 4:88735040-88735062 ACGGGTTCCAGACCTTTCAGTGG - Intronic
978034814 4:103979004-103979026 ACTGGTTACAGAATTTTCTGGGG - Intergenic
978552989 4:109948181-109948203 CCAGGTTCCAGATTTGTCTGTGG - Intronic
980871941 4:138621958-138621980 CTGGGTTCCACAGTTCTCTTCGG - Intergenic
983090096 4:163493240-163493262 ACAGGTTGCAGAATTTTCTGGGG - Intergenic
986254314 5:6089022-6089044 ACCGGTTACAGAATTTTCTGGGG - Intergenic
986307649 5:6527729-6527751 TCGGGATCCAGAGTGTTCTGAGG - Intergenic
992178250 5:74172104-74172126 ACAGGTTCCAGAGGTCCCAGGGG + Intergenic
992342784 5:75843456-75843478 TCGGAGTCCAGAGTTTTCTGTGG - Intergenic
995850184 5:116536685-116536707 ACTGGTGCCAGTGTCCTCTGTGG - Intronic
997503161 5:134394671-134394693 TTGGGCTCCAGAGTTCTCTTTGG + Intergenic
1000086355 5:157890854-157890876 ACTGGTTACAGAATTTTCTGGGG + Intergenic
1000566857 5:162858643-162858665 AGGTGTTCCACATTTCTCTGAGG - Intergenic
1001128635 5:169044615-169044637 ATGGGTACCAGATTTCTCTTTGG + Intronic
1001496113 5:172188467-172188489 ACAGTTTCCAGAGTGCCCTGCGG - Intergenic
1003707486 6:8550152-8550174 ACTGGGTCCAGAGTTCTTTGAGG + Intergenic
1004416852 6:15432535-15432557 ACTGGTTGCAGAATTTTCTGGGG + Intronic
1009477683 6:64114782-64114804 AAAGCTGCCAGAGTTCTCTGTGG - Intronic
1013589905 6:111611192-111611214 AGGGGCTGAAGAGTTCTCTGAGG + Intergenic
1014199418 6:118591656-118591678 TCTGGTTACAGAATTCTCTGGGG - Intronic
1021028281 7:15696792-15696814 ACCGGTTACAGAATTTTCTGGGG - Intergenic
1021500488 7:21328044-21328066 ACTGGTTACAGAATTTTCTGGGG + Intergenic
1022457581 7:30572576-30572598 ACTGGTTACAGAATTTTCTGGGG + Intergenic
1023029954 7:36082849-36082871 GGGGGTTCGAGAGTTGTCTGAGG + Intronic
1023660962 7:42470412-42470434 ATGGTTTCAAGAGTTCACTGGGG - Intergenic
1024569409 7:50711343-50711365 CCGGGTCCCAGAGCTCCCTGGGG + Intronic
1024918087 7:54525821-54525843 TCTGGTGCCAGAGTTCTCTGTGG + Intergenic
1026848707 7:73711838-73711860 ACAGGTGCCAGGGGTCTCTGAGG - Intronic
1027419146 7:78003018-78003040 TCTGGTTCCAGAGGACTCTGGGG + Intergenic
1027775860 7:82463518-82463540 ACTGGTTACAGAATTTTCTGGGG + Intergenic
1030366472 7:108652907-108652929 CCTGGTTACAGAGTTGTCTGGGG + Intergenic
1030866203 7:114704423-114704445 AAGGGTGACAGAGGTCTCTGAGG + Intergenic
1031997358 7:128241367-128241389 CCGGGATCCAGAGTTGTGTGGGG - Intronic
1032086864 7:128888968-128888990 ACAGGTTGCAGGGTTCTCGGGGG + Exonic
1034430068 7:151036720-151036742 ACGGGTGCCAGCCTTCTCTGGGG + Intronic
1041491572 8:58438536-58438558 CCGGGTTTCAGACTTCTGTGGGG + Intronic
1044081720 8:87893323-87893345 AAGTTTTCCAGAGATCTCTGTGG - Intergenic
1046849496 8:118956126-118956148 AAGGGTTAGAGAGTTCTCTGGGG + Intergenic
1047189098 8:122661786-122661808 ATGAGTTCCAGAGGGCTCTGTGG - Intergenic
1048962379 8:139591231-139591253 TCCAGTTCCAGAGTTCCCTGTGG + Intergenic
1055352353 9:75402691-75402713 ATTGGTTCCAGAATTCTCTGAGG + Intergenic
1057177037 9:93007902-93007924 TCGGGTTGGAGAATTCTCTGCGG - Intronic
1058971582 9:110088171-110088193 ACTGGTTACAGAATTGTCTGGGG + Intronic
1059355720 9:113697960-113697982 ACTGGCTCCAGAGTTCTCCAGGG + Intergenic
1059500956 9:114753728-114753750 GTGGCTTCCAGGGTTCTCTGGGG + Intergenic
1060257782 9:122047692-122047714 AGTGGTTCCAAAGCTCTCTGTGG - Intronic
1185550436 X:979733-979755 ACTGTTTCCAGAGCTCTCTTAGG - Intergenic
1186818241 X:13259114-13259136 ACTGGTTACAGAATTTTCTGGGG - Intergenic
1187335375 X:18376890-18376912 ACTGGTTACAGAATTTTCTGGGG - Intergenic
1190380043 X:49830064-49830086 ACAGGTTTCGGAGTTCTCAGTGG + Intronic
1190534215 X:51409317-51409339 ACGGGCTCCTGAGGTCTTTGGGG + Intergenic
1196856227 X:119987563-119987585 CCAGGTTCCAGGCTTCTCTGAGG + Intergenic
1199340470 X:146671306-146671328 AGTAGTTCCAGTGTTCTCTGAGG - Intergenic
1199547342 X:149019830-149019852 GCTGGTAGCAGAGTTCTCTGAGG + Intergenic
1200249983 X:154547554-154547576 CCGGCTTCCCGAGTTCTCGGGGG + Intronic
1200866838 Y:8052853-8052875 AAGGGTTACAAAGCTCTCTGAGG - Intergenic