ID: 932776355

View in Genome Browser
Species Human (GRCh38)
Location 2:74530312-74530334
Sequence TTCGCGCGCGTGGCTGGCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932776344_932776355 21 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776345_932776355 14 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776342_932776355 22 Left 932776342 2:74530267-74530289 CCCAGATACCAGGACCCGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 125
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776347_932776355 7 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776346_932776355 8 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776349_932776355 -1 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776341_932776355 23 Left 932776341 2:74530266-74530288 CCCCAGATACCAGGACCCGGGAG 0: 1
1: 0
2: 2
3: 16
4: 140
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932776355 Original CRISPR TTCGCGCGCGTGGCTGGCGG TGG Exonic
900240743 1:1616148-1616170 TTCGTGCCCGTGGCTCGCGGAGG - Intronic
901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG + Exonic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
914746702 1:150506466-150506488 TGCGCGCGCGTGTCTGAAGGGGG - Intronic
919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG + Exonic
923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG + Intergenic
923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG + Intronic
1066464891 10:35642343-35642365 TTGGCTCGCGGGGCTGGGGGCGG - Intergenic
1068560812 10:58512876-58512898 CGCGCGGGCGTTGCTGGCGGGGG + Intergenic
1083594018 11:63910488-63910510 TTGGGGCGCTTGGCTGGTGGTGG + Exonic
1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG + Exonic
1096337058 12:50764411-50764433 GTCGCGCGCGGTGGTGGCGGTGG + Intronic
1103019392 12:117521799-117521821 TTCGCACGATTGGCTGGCAGAGG - Intronic
1103441610 12:120967083-120967105 TTCGGTCGCGGGGCTGGCTGAGG - Intergenic
1103930555 12:124448538-124448560 TTCACCAGCGTGGCTGGCGGGGG - Intronic
1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG + Intronic
1112652609 13:101416019-101416041 TTCCTGCGCGTGGGTGTCGGGGG - Intronic
1113962213 13:114132404-114132426 GTCGGACGCGTGGCTGCCGGCGG + Intronic
1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG + Intronic
1136281704 16:29217285-29217307 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1142086081 16:88183202-88183224 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1142591166 17:1006738-1006760 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591186 17:1006803-1006825 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591206 17:1006868-1006890 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591226 17:1006933-1006955 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591246 17:1006998-1007020 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591266 17:1007063-1007085 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591286 17:1007128-1007150 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1149597889 17:57874842-57874864 TTCGGGCGGGTGGCCGGCGGCGG + Intronic
1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG + Exonic
1152466656 17:80470459-80470481 TGTGCGTGCGTGGCTGGGGGAGG - Exonic
1154173759 18:12068362-12068384 CTCGCGGGCCTGGCTGTCGGAGG + Intergenic
1154196595 18:12271683-12271705 CTGGAGCGCGTGGCCGGCGGTGG - Intronic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1161007585 19:1944233-1944255 TTCTCTCGTGTGGCTGCCGGCGG - Intronic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1161752924 19:6110542-6110564 TGCGCGAGGCTGGCTGGCGGCGG - Intronic
1163631413 19:18419683-18419705 CTCGCGGGCCTGGCTGTCGGAGG - Exonic
1167455384 19:49594948-49594970 TTCGAGCGCCTGGCAGGGGGCGG + Exonic
924985237 2:264384-264406 CTCGCGCACGTGGCGGGCTGTGG - Intronic
931355785 2:61537305-61537327 TTCGCGTGTGCGGGTGGCGGTGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
942034726 2:171999832-171999854 TGCGCGCGCGGGGCTGACTGCGG - Exonic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1183649445 22:39145655-39145677 TGCGTGCGCGCGGCCGGCGGGGG - Intronic
1184131649 22:42519973-42519995 TTCGCACTCGTGACTGGCCGGGG - Intergenic
1184141867 22:42582188-42582210 TTCGCACTCGTGACTGGCCGGGG - Intergenic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
952867243 3:37862142-37862164 CCCGCGCGCTTGGCTTGCGGGGG + Intronic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG + Exonic
968495300 4:912054-912076 ATCCCGCGCGTGGCAGGAGGAGG + Intronic
985611381 5:891539-891561 TGCGCCTGCGTGGCTGGAGGAGG - Intronic
996746890 5:126853654-126853676 TTCACTCTGGTGGCTGGCGGGGG - Intergenic
997237154 5:132279333-132279355 CGCGCGCGCGTGGGTGTCGGGGG - Intronic
1004396121 6:15248122-15248144 TGCAAGCCCGTGGCTGGCGGCGG + Intronic
1004561804 6:16759968-16759990 TGCGCGCGCGCGCCGGGCGGGGG - Intronic
1006814337 6:36840127-36840149 TGTGCGCGCGTGGCGGGCCGGGG + Intergenic
1007666542 6:43516835-43516857 TCCGCGCGCGGGGCTAGCGCGGG - Exonic
1007702272 6:43772065-43772087 TTCCCGCGGAGGGCTGGCGGGGG - Intronic
1007901990 6:45421761-45421783 TTCTCGCGGCCGGCTGGCGGCGG + Intronic
1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG + Intergenic
1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG + Intronic
1034415487 7:150962295-150962317 TTCGAGGGCCTGGCTGGCTGTGG - Intronic
1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG + Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1052814011 9:33085766-33085788 ATCCCGCGCGTGGCTCGGGGGGG + Intergenic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1062349899 9:136133457-136133479 TCCGGGCGCGGGGCTGGGGGCGG - Intergenic
1185471604 X:387000-387022 GGGGCGCGCGTGGCTAGCGGCGG - Intergenic