ID: 932776355

View in Genome Browser
Species Human (GRCh38)
Location 2:74530312-74530334
Sequence TTCGCGCGCGTGGCTGGCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932776346_932776355 8 Left 932776346 2:74530281-74530303 CCCGGGAGGCCTCAGAGAACTCT 0: 1
1: 0
2: 8
3: 105
4: 500
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776345_932776355 14 Left 932776345 2:74530275-74530297 CCAGGACCCGGGAGGCCTCAGAG 0: 1
1: 1
2: 3
3: 27
4: 253
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776342_932776355 22 Left 932776342 2:74530267-74530289 CCCAGATACCAGGACCCGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 125
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776347_932776355 7 Left 932776347 2:74530282-74530304 CCGGGAGGCCTCAGAGAACTCTG 0: 1
1: 1
2: 2
3: 33
4: 280
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776341_932776355 23 Left 932776341 2:74530266-74530288 CCCCAGATACCAGGACCCGGGAG 0: 1
1: 0
2: 2
3: 16
4: 140
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776344_932776355 21 Left 932776344 2:74530268-74530290 CCAGATACCAGGACCCGGGAGGC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62
932776349_932776355 -1 Left 932776349 2:74530290-74530312 CCTCAGAGAACTCTGGAACCCGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932776355 Original CRISPR TTCGCGCGCGTGGCTGGCGG TGG Exonic