ID: 932778565

View in Genome Browser
Species Human (GRCh38)
Location 2:74544887-74544909
Sequence CCCTGGGAGATTCTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932778565_932778573 8 Left 932778565 2:74544887-74544909 CCCCATCACAGAATCTCCCAGGG 0: 1
1: 1
2: 4
3: 30
4: 248
Right 932778573 2:74544918-74544940 ATCTCTTTCCCCACGAAGAATGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932778565 Original CRISPR CCCTGGGAGATTCTGTGATG GGG (reversed) Intronic
900094025 1:933098-933120 CCCTGAGAGTCTCTGTGGTGGGG - Intronic
900300791 1:1976148-1976170 CTCTGGGAGATTCGGCCATGGGG - Intronic
901852180 1:12022551-12022573 TCCTGGGAGATACTGTGAGTTGG + Intronic
903001158 1:20266836-20266858 CCCTGGGACAAGCTGTGCTGTGG - Intergenic
903344689 1:22676881-22676903 CCCTGGGAAATTCTGGGAGGTGG + Intergenic
904435158 1:30490231-30490253 CCCTGGGACAGTGTGTGGTGAGG + Intergenic
905269580 1:36778723-36778745 CCTTGGGAGACTTTGTGATCTGG - Intergenic
905313229 1:37065023-37065045 CCATGGGAGATTTTGTCATGGGG + Intergenic
905803334 1:40859731-40859753 CCCTAGGTGCTTCTGAGATGTGG - Intergenic
908460979 1:64348139-64348161 CCCTTGGAGATTCTCTTAAGAGG + Intergenic
908993894 1:70128722-70128744 GACTGTGAGATTCTGTGCTGAGG - Intronic
916475685 1:165166420-165166442 TCCTGGGAGAGCCTGTGATAAGG + Intergenic
918143839 1:181738944-181738966 CCCTGGGTGACTATGAGATGGGG + Intronic
918241791 1:182626764-182626786 CTCTGTGTGATACTGTGATGTGG - Intergenic
918262699 1:182810089-182810111 CCCTGGAGGACTCTGTGATTGGG + Intronic
918380900 1:183954086-183954108 CCATGAGAGAGTCAGTGATGTGG + Intronic
918479182 1:184959185-184959207 CACTGGGAGCTGCTGAGATGTGG - Intronic
918963334 1:191307158-191307180 CCCTGGGAGCTGCTGTGATGGGG - Intergenic
919246912 1:194999939-194999961 CCCTCAGAGATTCTGTGAACAGG - Intergenic
919453845 1:197800801-197800823 CCCTGGGAGCCACTGTGATGAGG + Intergenic
919938751 1:202272058-202272080 CCCAGGGGGCTCCTGTGATGTGG - Intronic
920065134 1:203263820-203263842 CCCTGGGAAGGTCTGTGGTGCGG + Intronic
920516340 1:206587175-206587197 CCTTGGCAGAATCTGTGGTGGGG - Exonic
920779197 1:208971391-208971413 CCCACGGAGACTCTGTGATTTGG - Intergenic
922180859 1:223231677-223231699 TCCTGGGAGATCCAGGGATGTGG + Intronic
922194806 1:223350784-223350806 CCCTGGAGGAATCTGTAATGTGG + Intronic
922755872 1:228096720-228096742 CCCTGGAAGGTTCTGTGTTGGGG + Intronic
924179169 1:241424126-241424148 CCCTGGGGGCTGCAGTGATGGGG + Intergenic
924552305 1:245090037-245090059 CCCTGGAAGATTTTGTGCTCAGG + Intronic
1063204196 10:3814978-3815000 CCCTAGGATATTTTTTGATGTGG + Intergenic
1063519804 10:6730905-6730927 CCAGGGGTGATTCTGTGAGGGGG + Intergenic
1064880589 10:20048607-20048629 CACATGGAGATTCTGTGACGTGG + Intronic
1065881545 10:30041592-30041614 CCTAGGGAGAGTCTCTGATGTGG - Intronic
1067232155 10:44419466-44419488 CCCTCGGGGATTCTGGGAGGAGG + Intergenic
1068083344 10:52346754-52346776 CCCTGGGGGCTGCTGTGATGTGG + Intergenic
1068355808 10:55907151-55907173 CCCAGGGGGTTTCTGTGGTGGGG + Intergenic
1068867986 10:61915327-61915349 CAAAGGGTGATTCTGTGATGTGG + Intronic
1069336398 10:67356477-67356499 TACTGGGAGATTCAGTTATGTGG - Intronic
1074975082 10:118573543-118573565 CCCAGAGAGGTGCTGTGATGGGG - Intergenic
1074975140 10:118574089-118574111 CCCAGAGAGGTGCTGTGATGGGG - Intergenic
1075448702 10:122531993-122532015 GGCTGGGAGTTTCTGGGATGAGG + Intergenic
1075914240 10:126153796-126153818 CCATGGGAGTTTCACTGATGTGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077383720 11:2259367-2259389 GCCTGGGAGCCTCTGTGATAGGG + Intergenic
1082219508 11:49617611-49617633 TCCTGGGAGATCCTATGATAGGG + Intergenic
1082954682 11:58857398-58857420 CCCTGGGTGATTCTGGGACCTGG + Intronic
1083926809 11:65812262-65812284 CCCTGGGAGTTTGCGGGATGAGG + Intergenic
1084085067 11:66851267-66851289 CCCTTGCAGGTTCTGTGAAGTGG - Exonic
1084672437 11:70615251-70615273 TCCTGGTGGACTCTGTGATGAGG + Intronic
1085479685 11:76810884-76810906 CCCCAGGAAATTCTGTAATGGGG - Intergenic
1085779356 11:79394316-79394338 CCTTGGGAGCTGCTGGGATGCGG - Intronic
1086630123 11:89007161-89007183 TCCTGGGAGATCCTATGATAGGG - Intronic
1087461361 11:98453108-98453130 CCCTAGCAGAGTGTGTGATGGGG + Intergenic
1087899008 11:103619447-103619469 CTCTGGGAGATAGTGTGATATGG - Intergenic
1089674560 11:120081240-120081262 CCGTGGGAAATGCTGGGATGAGG - Intergenic
1090867892 11:130718401-130718423 GCCTGGGAAAATCTGTGACGAGG + Intergenic
1091581664 12:1794024-1794046 CTCTGGGAGCATCTCTGATGGGG + Intronic
1092225354 12:6744880-6744902 CCCTTGGAGAGCCTGTGTTGGGG - Intergenic
1092406238 12:8223820-8223842 CTCTGGGAGATTCAGGGACGGGG - Intronic
1094361791 12:29638775-29638797 CCCTGGCAGGGTGTGTGATGGGG - Intronic
1095713523 12:45316101-45316123 TCCTGTGACATTCTGTAATGTGG - Intronic
1096758636 12:53820958-53820980 CCATTTCAGATTCTGTGATGTGG + Intergenic
1101521979 12:105492455-105492477 CCGAGAGAGATTCTGTGATTTGG - Intergenic
1102346043 12:112162039-112162061 TGCTGGGTGGTTCTGTGATGGGG + Exonic
1104253845 12:127123212-127123234 CCCTGTGAGCTTCTGTGGTAGGG + Intergenic
1105464828 13:20629702-20629724 CTCTGACAGATTCTGAGATGTGG - Intronic
1106470369 13:30049060-30049082 CAACGGGAGATTCAGTGATGTGG + Intergenic
1107634522 13:42378757-42378779 CCCTGGTGGTTTTTGTGATGTGG + Intergenic
1111227484 13:85293400-85293422 CCCAGGGAGATTCTGTGACCTGG - Intergenic
1112622119 13:101063422-101063444 CCCAGGCAAAATCTGTGATGGGG - Intronic
1114653189 14:24299701-24299723 CCCGGGGCGATTCTGTGCTGAGG + Exonic
1115344729 14:32330164-32330186 CCCTGGGAGAGCCTCTGAAGTGG + Intronic
1115816060 14:37165710-37165732 CCCTGGGAGGTTCTGAGGTTGGG + Intronic
1117345001 14:54823058-54823080 CCCTGGGAGAATCTGGGAGCAGG - Intergenic
1117881208 14:60315397-60315419 GCCTGGGAGGCTCTGGGATGGGG - Intergenic
1118402560 14:65393330-65393352 CCCAAAGAGATTCTGTGCTGTGG + Intergenic
1118473263 14:66094295-66094317 CCCTGGGAGCCGCAGTGATGGGG - Intergenic
1119748223 14:77059443-77059465 CCATGGGAGAGTCTTTTATGTGG - Intergenic
1120405596 14:84090718-84090740 CCCTGGGAACTGCTGTGATAAGG + Intergenic
1122631301 14:103108930-103108952 CTTTTGGAGATTCTGGGATGTGG + Intronic
1124638257 15:31378629-31378651 CCCTGGGTGAGGCTGAGATGTGG - Intronic
1125289545 15:38130611-38130633 CCCTGGGAGATTCTGGAATAAGG + Intergenic
1125435162 15:39636542-39636564 CCCTGTGACCTTCTCTGATGAGG - Intronic
1125890991 15:43267148-43267170 CCCAGGGAGGTGCTGTGCTGTGG + Intergenic
1126679077 15:51186748-51186770 CCCTGGGAGTTAGAGTGATGGGG + Intergenic
1127834452 15:62779300-62779322 TCCTGTGGGATTTTGTGATGTGG + Intronic
1128411554 15:67403962-67403984 ACCCTGGAGATTCTGGGATGTGG + Intronic
1129377899 15:75145597-75145619 CCCTGGGAGCCACTGTGATGAGG - Intergenic
1130047205 15:80454502-80454524 CCCTGGGAGCTGCTGGAATGTGG + Intronic
1131122043 15:89828784-89828806 GCCTGGGAGAGTCAGAGATGAGG - Intergenic
1131872955 15:96779669-96779691 CCCTGGGAAGTTCAGTTATGAGG - Intergenic
1132202295 15:99963354-99963376 CCCTCGGGAATCCTGTGATGAGG - Intergenic
1132415480 15:101615867-101615889 CCCTGGGAGGGTCTGAGCTGTGG - Intergenic
1132661689 16:1064355-1064377 CCCTTGGAGACTTTGGGATGTGG - Intergenic
1134347081 16:13401110-13401132 CCTTGGGAGATTCTGTGGGATGG - Intergenic
1134568337 16:15270176-15270198 CCCTAGGTGATTCTAAGATGAGG + Intergenic
1137505988 16:49054057-49054079 CCCTGGGAGACACTGGGGTGGGG - Intergenic
1138311946 16:56032893-56032915 TTCTGTGAGATTCTGTTATGAGG - Intergenic
1140933941 16:79653465-79653487 CCCTGGGAGAGTGGCTGATGAGG + Intergenic
1141458861 16:84164353-84164375 TTCTGTGAGATACTGTGATGGGG - Intronic
1141752659 16:85969506-85969528 CCTTGTGAGGTTCTGTGATTTGG + Intergenic
1142117694 16:88368570-88368592 CCCTGGGAGAGTTTGTGGTCTGG + Intergenic
1142595097 17:1026046-1026068 CCCTGGGAGAGTCTGTCACAGGG - Intronic
1143091710 17:4452829-4452851 CCCTGGGAGTATCAGTGAGGAGG + Intronic
1143275942 17:5710850-5710872 CTCTGGTAACTTCTGTGATGTGG + Intergenic
1145294076 17:21574464-21574486 CCCTGGGAATCGCTGTGATGGGG + Intergenic
1145369759 17:22298722-22298744 CCCTGGGAATCGCTGTGATGGGG - Intergenic
1146380435 17:32323497-32323519 CCCCTGGGGATTCTGTGGTGTGG + Exonic
1146624366 17:34424538-34424560 CTCTGGGAGGTGCTGGGATGAGG - Intergenic
1147537943 17:41333116-41333138 CCCTGGGAAATGCTGGGATGGGG - Intergenic
1148075402 17:44932702-44932724 TCCTGGGAGGTCCTGTGGTGGGG + Exonic
1149263291 17:54901324-54901346 CTCTGGGAGACTAAGTGATGTGG + Intronic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1151280876 17:73073208-73073230 CCCTTAGAGTTTATGTGATGAGG - Intronic
1153591348 18:6676581-6676603 CCCTGGAAGAGTCAGGGATGTGG - Intergenic
1157576846 18:48749340-48749362 CCGAGGGAAATACTGTGATGGGG - Intronic
1158015075 18:52774609-52774631 CCCTCGCAGAGTGTGTGATGGGG + Intronic
1158023525 18:52870077-52870099 CCCTGAGAGCTACTGTGATGGGG - Intronic
1161347993 19:3777584-3777606 CCCTGGGGGATTCTGGGCAGGGG - Intergenic
1161907289 19:7166284-7166306 CCCTGGGTGGTTCTGTGATTTGG + Exonic
1163659768 19:18569690-18569712 CCCTGGGAGTGTGTCTGATGGGG - Intergenic
1165452965 19:35895932-35895954 CCCTGGGAGATTGTGTGGAATGG - Intronic
926855989 2:17256716-17256738 CCCTGGGAGCTTCTCTCAAGTGG - Intergenic
928202476 2:29257140-29257162 CCCAGGGAGGATCTGGGATGGGG + Intronic
928230657 2:29495811-29495833 CCCTGGAAGATGCTGTCAGGAGG + Intronic
929584765 2:43106699-43106721 CCCTGGGTGATTCTGCTATGTGG - Intergenic
929972094 2:46589785-46589807 CTCTGGGAGATGCTGTTCTGTGG + Intronic
930740998 2:54832439-54832461 GCCTGGGCCATCCTGTGATGGGG + Intronic
931669485 2:64634359-64634381 TCCTGGGAGATAAGGTGATGGGG + Exonic
932778565 2:74544887-74544909 CCCTGGGAGATTCTGTGATGGGG - Intronic
937013526 2:118582850-118582872 GCCTGGGAGATGCAGTGAGGTGG + Intergenic
937404688 2:121616143-121616165 CCCAGGGAGATTTTTTAATGTGG - Intronic
938609170 2:132929156-132929178 TGCTGGCAGATTCTGTGTTGTGG - Intronic
938840186 2:135153668-135153690 CCCTGGAAGATTTTGTGAGGTGG + Exonic
940281110 2:151990466-151990488 CCGTGGGAAATGCTGTGATGTGG - Intronic
942053633 2:172163021-172163043 CCCTGGGAGCCACTGCGATGGGG - Intergenic
943283889 2:185972372-185972394 CCATTGGAGACTCTGTGAGGGGG - Intergenic
943419677 2:187655054-187655076 CCCTGGGAGTGACTGAGATGGGG - Intergenic
946714413 2:222538508-222538530 TCCCGGGAGATTCTCTGATGAGG + Intronic
947953988 2:234171753-234171775 TCCTTGGAGATGTTGTGATGTGG + Intergenic
1169811847 20:9616593-9616615 CCCTGGGAGCTTGTTAGATGTGG - Intronic
1170885796 20:20338895-20338917 CCCTGGGAGATTTTGACTTGCGG - Intronic
1171052665 20:21874441-21874463 GCCTGGGAGAATCTGTGATGGGG + Intergenic
1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG + Intergenic
1175321796 20:58093348-58093370 CTCTGGGCGAGTCCGTGATGTGG - Intergenic
1175468282 20:59207886-59207908 CCCTGGGGGATCCTTTGCTGGGG + Intronic
1175787202 20:61719296-61719318 CCTTGGAAGATTCTGCAATGAGG - Exonic
1181019363 22:20090917-20090939 CCCTAGAAGAGCCTGTGATGGGG + Intronic
1181439013 22:22926331-22926353 CCCTGGGAGGTTCTCTGGTGGGG - Intergenic
1183047171 22:35229426-35229448 CCCTAGCAGATGCTGGGATGTGG - Intergenic
1183122762 22:35743048-35743070 CCCTGGAAGTTTTGGTGATGAGG - Intronic
1183564211 22:38601521-38601543 CACTGGCAGATTCTGAGCTGGGG + Intronic
1183601932 22:38844705-38844727 CACAGGAAGATTCTGTAATGAGG - Intergenic
1184163905 22:42716213-42716235 CCCTGGGAGAGCCTGTGGTGAGG - Intronic
1184467972 22:44680062-44680084 TCCTGGGAGCTGCTGTGATTTGG + Intronic
1184797826 22:46742024-46742046 CCGTGGGAGAGTCTGAAATGTGG + Intergenic
1185019893 22:48367915-48367937 CCCTGGAAGATGCTGTGCAGAGG + Intergenic
949323880 3:2842318-2842340 CCCTGGAAGATTTTGTGTTTGGG - Intronic
952493900 3:33899192-33899214 ACCTGGGAGATGCTGCTATGAGG + Intergenic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
953152858 3:40341001-40341023 GCCAGGGCAATTCTGTGATGGGG + Intergenic
954315848 3:49801342-49801364 CCCTGGGACATTCCATGAGGTGG - Intergenic
954454301 3:50588795-50588817 GCCTGTGAGGTTCTGGGATGAGG + Intergenic
954904341 3:54047090-54047112 ACCTTGGAGACTATGTGATGTGG + Intergenic
956088559 3:65639555-65639577 TTCTGGGTGTTTCTGTGATGGGG + Intronic
960304973 3:116050160-116050182 CCCATGGAGATGCTGTGTTGTGG - Intronic
960690184 3:120338754-120338776 CCAAAGGACATTCTGTGATGTGG - Intronic
962423218 3:135246291-135246313 CACTTGGAGATTCTGTGACTGGG + Intronic
962454048 3:135548927-135548949 CCCTGGGTAATGCTGTGAGGAGG - Intergenic
963771495 3:149390993-149391015 CCCTGAGAGAGTCTGGGCTGTGG - Intergenic
964515872 3:157506894-157506916 CCCTGTGAGATTCTGAGCAGAGG + Intronic
970503436 4:16702599-16702621 CCCTTGCAGACCCTGTGATGTGG + Intronic
973734766 4:53860531-53860553 CCCTGGGAGATTCAGAGGTCTGG - Intronic
975598859 4:76078435-76078457 CTCTGGTACATTCTGTGCTGTGG + Intronic
979302459 4:119102371-119102393 CCCTGTAAGGTTCTGTGAAGGGG + Intergenic
980243001 4:130201835-130201857 CCCTGGGGGCTGCTGTGATGGGG + Intergenic
981837739 4:149075403-149075425 GCCTGGAAGATTCTGAGTTGAGG - Intergenic
981838161 4:149079677-149079699 CCCTGCTTGATTCTGTGTTGAGG + Intergenic
982158203 4:152541172-152541194 CCCTGGGGGCTGCTGTGATGGGG - Intergenic
982171245 4:152663620-152663642 TCCTGGGAGAGTTTGTGTTGCGG - Intronic
985176157 4:187204267-187204289 CACTGGGAGATTATGTAATTAGG + Intergenic
985358717 4:189148861-189148883 CCCAGGCAGAGCCTGTGATGAGG + Intergenic
986643279 5:9892459-9892481 CCCTGGGAAATTCTAAGGTGAGG - Intergenic
992342208 5:75836151-75836173 CCCTGGGAGTTTCAGACATGAGG - Intergenic
995332857 5:110965024-110965046 CCATGGCAGGTTCTGTCATGTGG - Intergenic
995538031 5:113156981-113157003 CCCTGGGAGAGTCTGTCATGAGG - Intronic
996566175 5:124881525-124881547 CCATGGGAGAATATGTTATGTGG - Intergenic
999164583 5:149537517-149537539 CACTGAGAAATTCTGTGCTGAGG - Intronic
1000044263 5:157508737-157508759 GCCTGGGAGAGACAGTGATGGGG - Intronic
1000655601 5:163874711-163874733 CCCTGGGACATTCTCTTAGGGGG + Intergenic
1001537577 5:172508912-172508934 CTCTGGGAGAGTGTGTAATGTGG - Intergenic
1005465455 6:26108274-26108296 CCCTGGGAGATTCTGTAAAGAGG - Intergenic
1006518732 6:34559199-34559221 CCCTGAGAGTTACTGTGAGGAGG + Intergenic
1010396672 6:75400706-75400728 CCATGGGAGATTCAGGGATGGGG + Intronic
1011912946 6:92465418-92465440 CCATGGGGGATTCTGTGTGGGGG + Intergenic
1013630614 6:111982721-111982743 CCCTGGAATATGCTTTGATGTGG + Intergenic
1014139736 6:117927526-117927548 CCCTGGGAGATGCTGGGAGCAGG + Intronic
1014736506 6:125100614-125100636 TCCTTGCAGACTCTGTGATGGGG - Intergenic
1014747250 6:125214414-125214436 CCCTGGTAGATTGTGGGAAGAGG - Intronic
1015451006 6:133365744-133365766 CCCTGGGAGATTTAGGGAAGGGG + Intronic
1015495773 6:133881893-133881915 CACTGGCAGATTCTGTGAACTGG + Intergenic
1017095365 6:150800136-150800158 CCCTGTGAGAATCTTTGAAGAGG - Intronic
1017383052 6:153852268-153852290 CTCCAGGAGATTCTGAGATGTGG - Intergenic
1018176255 6:161181719-161181741 GCTTGGGAGATTCTGGGATGGGG - Intronic
1019196445 6:170285926-170285948 CCCTGAGTGATTCTAGGATGAGG + Intronic
1019224346 6:170498057-170498079 CTCTGGGAGACTCTGGGAGGAGG - Intergenic
1019586085 7:1804461-1804483 CCCTGTGTCATTCTGTGACGAGG + Intergenic
1021097091 7:16547238-16547260 CCCTGGGAGCTGCTGCAATGGGG + Intronic
1024505761 7:50159769-50159791 CCCTGAGAGATTCTGCGAGCTGG - Exonic
1025105569 7:56169333-56169355 TCCTGGCAGTTTCTCTGATGGGG - Intergenic
1026253230 7:68689119-68689141 CCCTGGGAAATTCTGTAACTGGG - Intergenic
1029612322 7:101633587-101633609 TTCTGGGAAATTCAGTGATGTGG - Intergenic
1030115411 7:106058942-106058964 CCCTGGCAGATCCTGGCATGTGG + Intergenic
1031146260 7:118000783-118000805 ACCTGGGAGAGACAGTGATGTGG + Intergenic
1031840963 7:126738751-126738773 CCCTGGGAAATTCTACGTTGAGG + Intronic
1032472457 7:132188495-132188517 CCCTTGGAGATGCTTTGATAGGG + Intronic
1032858875 7:135859086-135859108 CCCTGGGAGCTGCTGCCATGGGG - Intergenic
1033154479 7:138945164-138945186 CCCTGGGTGATTCTGAGAGCAGG - Intronic
1033732370 7:144192531-144192553 CTATGGGTGATTCTGTGATGTGG + Intronic
1033743218 7:144291111-144291133 CTATGGGTGATTCTGTGATGTGG + Intergenic
1033750680 7:144358484-144358506 CTATGGGTGATTCTGTGATGTGG - Intronic
1033810295 7:145003980-145004002 CACTGAGAGACTTTGTGATGAGG - Intergenic
1034967440 7:155400044-155400066 CCCTGTGCGATGCTGGGATGTGG + Intergenic
1036263501 8:7257894-7257916 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036264804 8:7265516-7265538 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036266103 8:7273138-7273160 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036267406 8:7280760-7280782 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036268708 8:7288382-7288404 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036270010 8:7296004-7296026 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036297884 8:7551051-7551073 CTCTGGGAGATTCAGGGACGGGG - Intergenic
1036299188 8:7558699-7558721 CTCTGGGAGATTCAGGGACGGGG - Intergenic
1036300493 8:7566349-7566371 CTCTGGGAGATTCAGGGACGGGG - Intergenic
1036301796 8:7573993-7574015 CTCTGGGAGATTCAGGGACGGGG - Intergenic
1036303093 8:7581642-7581664 CTCTGGGAGATTCAGGGACGGGG - Intergenic
1036315543 8:7716433-7716455 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036316851 8:7724081-7724103 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036318158 8:7731729-7731751 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036319467 8:7739377-7739399 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036320774 8:7747024-7747046 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036322084 8:7754672-7754694 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036323393 8:7762320-7762342 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036324689 8:7769967-7769989 CTCTGGGAGATTCAGGGACGGGG + Intergenic
1036351345 8:8014340-8014362 CTCTGGGAGATTCAGGGACGGGG - Intergenic
1036352650 8:8021986-8022008 CTCTGGGAGATTCAGGGACGGGG - Intergenic
1036353942 8:8029634-8029656 CTCTGGGAGATTCAGGGACGGGG - Intergenic
1036707201 8:11054812-11054834 CCCTGGGAGCTCCTGGGAGGAGG + Intronic
1036846608 8:12174759-12174781 CTCTGGGAGATTCAGGGACGGGG - Intergenic
1036867970 8:12417078-12417100 CTCTGGGAGATTCAGGGACGGGG - Intergenic
1037562317 8:20086061-20086083 CACTGGGAGGGTCTGGGATGGGG + Intergenic
1037754741 8:21703454-21703476 CCCAGGGAGAGCCTGTGGTGTGG - Intronic
1038524591 8:28262128-28262150 CGCTGGGTGTTTCTGTGAAGAGG + Intergenic
1038696034 8:29807260-29807282 CTCTGGGGGTTTCTGTGAAGGGG - Intergenic
1040286235 8:46101835-46101857 CCCTGGGAGATTCTGGGATGGGG + Intergenic
1040300114 8:46183571-46183593 ACCTGGGGGCTTCTGGGATGGGG + Intergenic
1040313465 8:46248828-46248850 CCCTGGGGGTTTCTGGGATGGGG - Intergenic
1040315039 8:46256526-46256548 CCCTGGGGGTTTCTGATATGAGG - Intergenic
1040325874 8:46341255-46341277 CCCTGGGGGATTCTGGGATAAGG - Intergenic
1041205644 8:55495544-55495566 CCCTGGAAGCCACTGTGATGGGG - Intronic
1043332972 8:79140253-79140275 TCCTGGGAGTTTATGTGATATGG - Intergenic
1044899489 8:96928699-96928721 CACTGGGAGAATCAGTGATGTGG - Intronic
1048856928 8:138694016-138694038 CTCTGGGAGACTCTGTGCTATGG - Intronic
1049229053 8:141472737-141472759 CCCTGGGAGGATCTGGGAGGAGG + Intergenic
1049252603 8:141597245-141597267 CCCTGGGAGCAACTCTGATGGGG - Intergenic
1056735165 9:89203251-89203273 CACTGGCAGATTCGGTGATGGGG + Intergenic
1057025973 9:91734009-91734031 CTCTGGAAGGTTCTGTGATAAGG + Intronic
1057879674 9:98783730-98783752 CATTGTGAAATTCTGTGATGGGG + Intronic
1058400593 9:104614195-104614217 CCCTGGCAGAGCATGTGATGGGG + Intergenic
1059257542 9:112945154-112945176 GCCTTGGAGATGCTGGGATGAGG + Intergenic
1060055374 9:120408634-120408656 CACTGGGAGATTCTGAGCAGAGG - Intronic
1062250171 9:135589924-135589946 CTCTGGGAGCTGCTGGGATGGGG - Intergenic
1062284841 9:135768319-135768341 CCGTGGGGGACACTGTGATGTGG + Intronic
1062615667 9:137394673-137394695 CCCTGCCAGATTCAGTGCTGAGG - Intronic
1062664045 9:137657290-137657312 CACTGGGAGATTCTGAGCAGAGG + Intronic
1185461531 X:334899-334921 CACTGGGAGCTTCTGTGCTTTGG - Intronic
1186389990 X:9149189-9149211 CCCCTGGAGAGCCTGTGATGGGG + Intronic
1188551440 X:31368952-31368974 CCCTTCTTGATTCTGTGATGAGG + Intronic
1189063873 X:37785270-37785292 CTCTGAAAAATTCTGTGATGAGG + Intronic
1189735054 X:44061665-44061687 CCCAGGAAGATCCTGGGATGTGG + Intergenic
1190876641 X:54464927-54464949 GCTGTGGAGATTCTGTGATGTGG + Intronic
1195711109 X:107774757-107774779 CCTTTGGAGATTCTGCCATGGGG - Intronic
1200839443 Y:7765611-7765633 CCCTGAGGGAGTGTGTGATGGGG - Intergenic