ID: 932779114

View in Genome Browser
Species Human (GRCh38)
Location 2:74549086-74549108
Sequence CGGCGCGCGCCCCGGGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 546}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932779107_932779114 -1 Left 932779107 2:74549064-74549086 CCTGGGAGTGGCCTCGCGAGGCC 0: 1
1: 0
2: 0
3: 9
4: 152
Right 932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG 0: 1
1: 0
2: 4
3: 75
4: 546
932779102_932779114 7 Left 932779102 2:74549056-74549078 CCCCCGCGCCTGGGAGTGGCCTC 0: 1
1: 1
2: 1
3: 16
4: 243
Right 932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG 0: 1
1: 0
2: 4
3: 75
4: 546
932779098_932779114 22 Left 932779098 2:74549041-74549063 CCAGCGCTGGAATCGCCCCCGCG 0: 1
1: 0
2: 1
3: 5
4: 48
Right 932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG 0: 1
1: 0
2: 4
3: 75
4: 546
932779104_932779114 5 Left 932779104 2:74549058-74549080 CCCGCGCCTGGGAGTGGCCTCGC 0: 1
1: 0
2: 0
3: 23
4: 135
Right 932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG 0: 1
1: 0
2: 4
3: 75
4: 546
932779103_932779114 6 Left 932779103 2:74549057-74549079 CCCCGCGCCTGGGAGTGGCCTCG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG 0: 1
1: 0
2: 4
3: 75
4: 546
932779105_932779114 4 Left 932779105 2:74549059-74549081 CCGCGCCTGGGAGTGGCCTCGCG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG 0: 1
1: 0
2: 4
3: 75
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932779114 Original CRISPR CGGCGCGCGCCCCGGGGCCG AGG Intronic
900082676 1:870094-870116 CGGCGCGCTCCGCGGGGCAGAGG + Intergenic
900191780 1:1355174-1355196 CGGCGCGCGGGCCGGGGCGGCGG + Intronic
900226633 1:1536189-1536211 ACCCGCCCGCCCCGGGGCCGCGG + Intronic
900283913 1:1890497-1890519 CGGCCGGGGCCCCGGGGGCGCGG - Intronic
900513015 1:3069321-3069343 CGGCCCGGGCCCCGGCGGCGCGG - Intronic
901022120 1:6260887-6260909 CTGCGCTCGGCCCGGGGGCGCGG - Exonic
901433881 1:9234722-9234744 GGGCGCGCGCGGCGGGGGCGGGG - Intergenic
901443399 1:9292947-9292969 AGGCGCCGGCGCCGGGGCCGGGG + Exonic
901443401 1:9292953-9292975 CGGCGCCGGGGCCGGGGCCGCGG + Exonic
901556067 1:10032631-10032653 CGCGGCGGGCCCCCGGGCCGCGG + Intergenic
902169589 1:14599135-14599157 CGGCCCGGGCCCGGGAGCCGCGG + Exonic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
903263359 1:22142934-22142956 GGGCGCCCGGCCCGGGGCAGCGG + Exonic
903349812 1:22710902-22710924 GAGCGCGCGCCCCGGGCTCGGGG - Intronic
903350087 1:22711713-22711735 CGGCCACCGCCCCGCGGCCGCGG + Intronic
903750404 1:25617469-25617491 AGGCGCGGGCCCCGGCGCGGCGG + Exonic
903925223 1:26826906-26826928 CGGCGGGCGGCGCGGGCCCGGGG - Exonic
904160390 1:28518487-28518509 TGGAGCGCCCCGCGGGGCCGGGG - Intronic
904215404 1:28914789-28914811 CGGCGCGGGAGCCGGGGCGGTGG + Intronic
904500118 1:30908520-30908542 CGGCGCCGGGGCCGGGGCCGCGG - Exonic
904500120 1:30908526-30908548 CGGGGCCGGCGCCGGGGCCGGGG - Exonic
904641954 1:31937944-31937966 CGGCCCCCGCGCCGGCGCCGGGG - Intronic
904769081 1:32870946-32870968 CGTCGGGCGCCCGGGGGGCGGGG + Intronic
905137089 1:35808242-35808264 CGGCGCCCGGCCCGGGGACAGGG - Exonic
906376905 1:45303636-45303658 CGGAGCGGGGGCCGGGGCCGAGG + Intronic
906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG + Exonic
906637008 1:47416479-47416501 CCGCGCCCGGCCCGGGGCGGCGG + Exonic
906640200 1:47437174-47437196 CGGCCCGCGCCCCGGGAACGCGG + Exonic
906917187 1:50023995-50024017 GGGCTCGCGCCGCGGGGGCGGGG - Intergenic
907237773 1:53063254-53063276 TGCCGCGCGCACCGGGGCCGGGG - Intronic
907341520 1:53739076-53739098 GGGGGCGCGGCCCGCGGCCGAGG - Intergenic
907689118 1:56645176-56645198 CGGCGGGCGGGGCGGGGCCGAGG - Intronic
908477628 1:64505526-64505548 CGGGGCGCGGCCCGGGGGCGGGG - Intronic
908544063 1:65147715-65147737 CGTCGCGCGCCCCATGGCCGGGG + Intronic
909475217 1:76074624-76074646 CGGCACGTGACCCGGGGGCGGGG + Intergenic
911647466 1:100352231-100352253 CCGCCCGCTCCCCTGGGCCGAGG + Intronic
912381290 1:109249576-109249598 CGGGGCTGGGCCCGGGGCCGCGG + Intergenic
912435105 1:109656261-109656283 CGGCGGGCGCAGCGGGGCCGAGG + Exonic
912492674 1:110070636-110070658 CAGCGCGAGCCCCGGAGCCCCGG - Exonic
912492710 1:110070727-110070749 CGGCGCGCGCCGCGGGGGGCGGG + Intronic
913109236 1:115642440-115642462 CGGTGCGCGTGCCGGGGCGGCGG + Intronic
914376381 1:147077278-147077300 GGGCGCGCGCACCGGGGTGGAGG + Intergenic
914869130 1:151458827-151458849 CGGCGGGCGCCGGGGGGCGGGGG + Intronic
915224962 1:154405438-154405460 CCGAGCGCGGCGCGGGGCCGAGG + Exonic
915343829 1:155189536-155189558 CGGCCTGCTCTCCGGGGCCGAGG + Intronic
915343848 1:155189596-155189618 CGGCCTGCTCTCCGGGGCCGAGG + Intronic
915344047 1:155190076-155190098 CGGCCTGCTCTCCGGGGCCGAGG + Intronic
915344068 1:155190136-155190158 CGGCCTGCTCTCCGGGGCCGAGG + Intronic
915916932 1:159945884-159945906 CGGCTCGCGCTCCAGGGCTGCGG + Intergenic
917817538 1:178725623-178725645 CGGCGCGCCTCCCTCGGCCGCGG + Intronic
917817663 1:178726025-178726047 CGGCCCGCGCGCCCGGCCCGAGG - Intronic
918282840 1:183023187-183023209 CGGCGCGCGACCCGGGGGGAGGG - Intergenic
920184592 1:204152085-204152107 CGGCCCGCGGGCCGGGGCGGGGG - Intergenic
921024045 1:211260543-211260565 CCTCGCTCGCCCCGGCGCCGAGG + Intronic
921155164 1:212433236-212433258 CGGCGGGCGCCCTGGGCCGGCGG + Intronic
921923138 1:220690451-220690473 CGCCGCGGGCCCCGAGGGCGAGG + Exonic
921923180 1:220690583-220690605 CTCCGCGCGCCCCGGGTCCCCGG - Exonic
922496648 1:226062657-226062679 TGGCGCGCGGCGCGGGGGCGGGG + Intronic
922674554 1:227542524-227542546 TGGCGTGCTCCCCGGGGCAGAGG - Intergenic
922739369 1:228006878-228006900 GGGGGCGCCCGCCGGGGCCGGGG - Intergenic
922757275 1:228103322-228103344 CGGCGCGCGACGCGGAGGCGGGG - Exonic
923372738 1:233328698-233328720 CGGCGCGCGCGGCGGGGGCCGGG - Exonic
923684139 1:236142391-236142413 GGGCGCGCGGGCCGGGGCGGGGG + Intergenic
923684149 1:236142411-236142433 GGGCGCGCGGGCCGGGGCGGGGG + Intergenic
924362340 1:243254915-243254937 CGCCGCCCGCCGCGGGGCGGGGG - Intronic
924502805 1:244653004-244653026 CGCCAGGCGCCCCGGGGGCGGGG - Exonic
924527243 1:244863623-244863645 CGGCGGTCGCCCCGGGGCTCCGG - Exonic
924560616 1:245154630-245154652 TGGCGCGCGGCCCGGGCCCGGGG - Intergenic
1062760133 10:11632-11654 CAGCGCGCTCCCGGGGGCAGAGG + Intergenic
1062843852 10:689890-689912 GCGCGCGCGTCACGGGGCCGCGG + Intergenic
1063395641 10:5684975-5684997 CGGCGAGGACCCCGGGGCTGGGG + Exonic
1063407873 10:5813679-5813701 CGGCGCGCGGGCCGGGGTGGAGG + Intronic
1063418236 10:5890296-5890318 CGGCGCGGGCCCGGCGGCGGCGG + Intronic
1063663949 10:8050947-8050969 AGGCGAGCTCCGCGGGGCCGAGG - Intergenic
1065140357 10:22714020-22714042 GGGCACGCGCCGCGGGGCTGGGG + Intronic
1067071933 10:43138627-43138649 CGGTGCGGGCGCCGGGGCTGCGG + Intronic
1069403642 10:68075388-68075410 CGGCGCAGGCGCCGGTGCCGGGG - Intergenic
1069942404 10:71964559-71964581 CCGCGCGGGCGCCGGGGCCGCGG + Exonic
1070086912 10:73246920-73246942 CAGCGCGCTCCCCCGGGGCGGGG + Intronic
1070570752 10:77638035-77638057 CGGCGGGCGGCGCGGCGCCGAGG - Intronic
1072059815 10:91798726-91798748 CTGCGCGAGCGCCGCGGCCGAGG + Exonic
1072151783 10:92690001-92690023 CGGCGCCCGCCGCCGGCCCGGGG - Exonic
1072654636 10:97321243-97321265 CGGAGCGCGGCCAGGGGCGGTGG - Exonic
1073099619 10:100999835-100999857 CGGCGCGCGGGCCAGGGCCGGGG + Exonic
1073208252 10:101779978-101780000 GGGCGGGCGCCGTGGGGCCGGGG - Intronic
1073363689 10:102919494-102919516 CGGCTCGGGCCTCGTGGCCGTGG + Exonic
1076258376 10:129046339-129046361 CGCCCGGCTCCCCGGGGCCGGGG + Intergenic
1076864498 10:133160289-133160311 CGGGGCGGGCCCGGGGGGCGCGG - Intergenic
1077008397 11:369599-369621 CGCCGCCCACCCCGGGCCCGCGG + Intergenic
1077008548 11:370048-370070 CGGCGGGGGCCCCGGGGCGCGGG + Intronic
1077103178 11:831061-831083 CGGTGCGTGTCCCGGGGGCGGGG + Intronic
1077107833 11:849648-849670 CGGCGCGGGCGAAGGGGCCGGGG + Intronic
1077214669 11:1390387-1390409 CGGGGCGGGGACCGGGGCCGGGG + Intronic
1077495488 11:2884854-2884876 CGGGGCGGGGGCCGGGGCCGGGG + Exonic
1077916054 11:6612115-6612137 GGGCGCGGGGCCCGGGGCCGAGG + Exonic
1078514103 11:12008508-12008530 CGGAGCGGGCGCGGGGGCCGTGG + Exonic
1079450798 11:20598361-20598383 CGGCGCGCACCCCGAGGCAGTGG + Intergenic
1080606632 11:33869622-33869644 CTGCGGGCGCGCCGCGGCCGAGG + Intronic
1080802138 11:35618778-35618800 CGGCGCCCGGCCCGGAGCGGCGG + Exonic
1081528363 11:43942392-43942414 AGCCGCGTGCTCCGGGGCCGCGG + Exonic
1081773977 11:45665438-45665460 GGACGCGGGACCCGGGGCCGGGG + Exonic
1081804985 11:45885616-45885638 CCGCGCGCGCCCCCGGGACCCGG - Intergenic
1081969191 11:47186426-47186448 CGGCGCGCTCCGGGAGGCCGCGG - Intronic
1082003676 11:47408476-47408498 CGCCGCGTGCCGCGGGGTCGGGG - Intronic
1082811707 11:57482620-57482642 AGGGGCGCGCCCTGGGGCAGAGG + Intergenic
1083033481 11:59615475-59615497 AGGCCCGGGCCCGGGGGCCGGGG - Exonic
1083033485 11:59615482-59615504 CGGCGGGAGGCCCGGGCCCGGGG - Exonic
1083655267 11:64226344-64226366 CCCCGCGCGCCCCGGGTCGGAGG + Exonic
1083727965 11:64638140-64638162 CGCCGCGGGCCTCGGGGGCGGGG - Intronic
1084074473 11:66762321-66762343 CGGGGCGGGCCCCGGGGGTGTGG + Intronic
1084129119 11:67119590-67119612 CTGTCCGCCCCCCGGGGCCGGGG + Intronic
1084336538 11:68460976-68460998 CGCCGCGCCTCCCGGGCCCGCGG - Intronic
1084527246 11:69704823-69704845 CCGCGCTCGCCCCGGCCCCGCGG + Intergenic
1084621100 11:70270769-70270791 GGCGGCGGGCCCCGGGGCCGCGG + Exonic
1084636755 11:70398287-70398309 CGCGGCGCTGCCCGGGGCCGGGG - Intergenic
1089065594 11:115659746-115659768 CACCGCGCGCCCCAGGGCCAGGG - Intergenic
1089180515 11:116580138-116580160 CGGCGGGCGCAGCGGGTCCGAGG + Intergenic
1091393262 12:138734-138756 GAGCGCGGGCCCCGGGCCCGGGG + Exonic
1091823374 12:3492222-3492244 CGGCTCGGCCCCCGCGGCCGGGG - Intronic
1091866116 12:3838888-3838910 CGGCGTGCGCGCCTGGGGCGGGG + Intronic
1091869176 12:3873171-3873193 CGGGGCGGGCCCAGGGGGCGGGG - Intronic
1092462507 12:8698425-8698447 CCGAGCGCGCCCGGGGTCCGGGG + Intronic
1094567868 12:31616481-31616503 CGGGGCTCCCTCCGGGGCCGCGG - Intergenic
1094807681 12:34108042-34108064 CGGCGCCCTCCCCGGGGCAGAGG + Intergenic
1095465388 12:42483624-42483646 CGGGACGCGACCCGGGGGCGCGG - Intronic
1096204164 12:49707293-49707315 CGGCGCCCTCGACGGGGCCGAGG - Exonic
1096260228 12:50085566-50085588 GGGCGCGCGGGCCGGGGGCGGGG + Intronic
1096647701 12:53047491-53047513 CGGGGCGCGGCCCAGGGCTGGGG + Intronic
1096668071 12:53180493-53180515 CGGCGCGTGCGCCGTGGCCGGGG - Intronic
1096791415 12:54047438-54047460 CGGCGCGCACCTCGCGGCCTGGG - Intronic
1096841026 12:54379236-54379258 CGGAGCCCGCCCCGGAGGCGGGG + Intronic
1097264573 12:57737982-57738004 CAGCGCGGGCACCGGGGGCGCGG - Exonic
1097891447 12:64781105-64781127 GGGCGGGGGCCGCGGGGCCGAGG + Intergenic
1098024669 12:66189270-66189292 CTGCCCGAGCCCCGGGGACGAGG - Exonic
1101592962 12:106139394-106139416 CTGGCCGAGCCCCGGGGCCGGGG + Exonic
1102025842 12:109714016-109714038 CCGCGCGCCGCCCGGGGCCATGG + Intergenic
1102197199 12:111034077-111034099 CGGCGGCGGCCCCGGGGCTGGGG + Exonic
1102278163 12:111598718-111598740 CGGCGCGGGCCGCGGGGGAGGGG + Intronic
1103488197 12:121296742-121296764 CGGCGGGCGCGCGGGGGGCGGGG + Intronic
1103500876 12:121400554-121400576 CGCCGCGCGCCAAGGGACCGAGG - Intronic
1103649707 12:122422835-122422857 CGGCGGGCGCGCCGGGGCCAGGG - Intergenic
1103779320 12:123388913-123388935 CGGCGCCCGGCCCGGGGAGGGGG - Intronic
1104448771 12:128853370-128853392 CGGCGCGAGCCCTGGGTGCGGGG - Intergenic
1104602381 12:130162395-130162417 GGGCGCGCGGCCCGGGGGCGGGG + Intergenic
1104977779 12:132559978-132560000 CGGCGCGGGCCCCGAGGCGGCGG - Intronic
1106157292 13:27171175-27171197 CAGAGCGCGGCCCCGGGCCGGGG - Intronic
1106157584 13:27172040-27172062 CGGCTCGCGCACAAGGGCCGCGG - Intergenic
1106735815 13:32586844-32586866 CGGCGCGCGCCTCCACGCCGCGG + Intronic
1108689297 13:52847431-52847453 CAGCGCGGGGCCCGGGTCCGCGG + Exonic
1110706153 13:78603166-78603188 GGGCGCGCGGGCCGGGGCCGCGG + Intronic
1112494774 13:99896074-99896096 CTCCGCGCGCACCGGGGGCGCGG - Exonic
1113820364 13:113209012-113209034 GCGCGCGCGCCCCGAGGCCCTGG - Intronic
1113820466 13:113209317-113209339 CGGTGCGCCCCCCGGAGCCGGGG + Intronic
1113914805 13:113863873-113863895 CGGCGCGCGGCGCAGGGCGGCGG + Exonic
1113914837 13:113863968-113863990 CCGCGGGCGCCGCGGGGCGGAGG + Exonic
1114514050 14:23286068-23286090 CGGCGCGCTCCCGGGGACGGTGG - Exonic
1114989056 14:28264440-28264462 CCGGGAGCGCCCCCGGGCCGCGG + Intergenic
1117478146 14:56118227-56118249 AGGCGCCCGCCCCCGGCCCGCGG - Intronic
1118220924 14:63853658-63853680 CGGTGCTCGCCCCGGGGACCCGG + Intronic
1118641745 14:67798894-67798916 CAGCGCCCTCCCCGGGGGCGGGG - Intronic
1119286394 14:73458362-73458384 CGGGGCCCGGGCCGGGGCCGGGG - Intronic
1119821021 14:77616418-77616440 GGGCCCGCGCGGCGGGGCCGGGG - Intronic
1120905690 14:89619174-89619196 CGGCGCCCGCCCGGGGTCGGCGG + Intergenic
1121050493 14:90816459-90816481 CGGCGGGCGCGGCGGGGCCCCGG + Intronic
1121546958 14:94769799-94769821 CGGCGCGGGCCTCCCGGCCGCGG - Exonic
1122558358 14:102593205-102593227 GGGCGCGGGGCCCGGGGCCGCGG - Intronic
1122558360 14:102593212-102593234 CGGCGCGGGGCGCGGGGCCCGGG - Intronic
1122975344 14:105168587-105168609 CGGCGCGCGGGCCTGGGCGGCGG + Exonic
1124469347 15:29969035-29969057 CGGAGCGCGCCGCCGGGCCACGG - Intergenic
1124500443 15:30223296-30223318 CGGGGCCCGCGCCGGGGCCGGGG + Intergenic
1125677856 15:41512067-41512089 CGGCGCCGGCGCCGGGGGCGAGG - Intronic
1125950305 15:43746286-43746308 CGGAGCGCGGGGCGGGGCCGAGG - Intergenic
1126134629 15:45378408-45378430 CGGCGGGAGCCGCGGCGCCGAGG - Exonic
1126137053 15:45402660-45402682 GTGCGCGAGCCCCGGGGCGGCGG + Exonic
1127103087 15:55587693-55587715 CCGCCGGCACCCCGGGGCCGAGG - Intronic
1127142728 15:55993749-55993771 CGGCGCGCGCTCCTGGGGCTGGG + Intergenic
1127342863 15:58065710-58065732 GCGAGCGCGCCCCCGGGCCGCGG - Exonic
1127982630 15:64046083-64046105 CGGAGGGCGCCCCAGGGCAGCGG + Intronic
1128067933 15:64775780-64775802 AGGCCGGCGCCCCGCGGCCGGGG - Intergenic
1128153544 15:65377856-65377878 CGGGGCCGGCGCCGGGGCCGGGG + Exonic
1128995153 15:72289815-72289837 AGGCGCTCGGCCCCGGGCCGGGG - Intronic
1130115418 15:81001385-81001407 CAGAGCGCGGCCCGGCGCCGCGG - Exonic
1131074507 15:89486769-89486791 CAGGGCGGGCCCCGGGGGCGTGG - Intronic
1131144048 15:90000465-90000487 AGCAGTGCGCCCCGGGGCCGAGG + Intergenic
1131257405 15:90871617-90871639 GGGCGCGGGGCCCGGGGCCCGGG + Intronic
1131257443 15:90871719-90871741 CGGCCCGAGCACCCGGGCCGCGG - Intronic
1131263714 15:90903343-90903365 CTCCGCGGGCCCTGGGGCCGAGG - Exonic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1131692795 15:94845046-94845068 CGGCGGGCGACCGGGGGACGGGG - Intergenic
1131827220 15:96331356-96331378 CGGAGCGCTGCCCGGGTCCGGGG - Exonic
1132527869 16:426321-426343 CGGAGCGCGGCCCTGGGCCCGGG - Exonic
1132843542 16:1989954-1989976 CGGCGCGCGCTCCCGGGAGGCGG + Exonic
1132889444 16:2196632-2196654 CGGGGGGCGGCCCGGGGGCGGGG + Intergenic
1132994740 16:2817194-2817216 CGGGGCGCCCCCTGGGGGCGGGG - Intronic
1133053920 16:3135296-3135318 CGCCGCTCGCCCCGCGGGCGAGG + Exonic
1133272030 16:4614976-4614998 CGCCGGGCGCCCCGGGGGAGCGG + Intronic
1134070054 16:11255359-11255381 CCGCGGGCGCGCGGGGGCCGCGG + Exonic
1134149829 16:11797050-11797072 CGGCGCGCGCGGGGGGGGCGGGG + Intronic
1134419304 16:14071268-14071290 CCGCGCGCGCCGCGGGGAGGAGG + Intergenic
1134849716 16:17470397-17470419 CGGCTCGCGCCCCGCGGCGAGGG - Intronic
1135607369 16:23836126-23836148 AGGTGCCGGCCCCGGGGCCGCGG - Exonic
1136111044 16:28063723-28063745 GGGCGCGCGTCCCTGCGCCGTGG - Intergenic
1136141645 16:28292546-28292568 CCGGGCGGGCGCCGGGGCCGGGG + Exonic
1136365122 16:29806260-29806282 CTGCGCGCGCACCGGGCGCGCGG - Intronic
1136428363 16:30183780-30183802 CGGCGCGCGCGTGGGAGCCGCGG + Intronic
1136630719 16:31487976-31487998 CGGGGCGCGGGGCGGGGCCGAGG + Intronic
1136737070 16:32475099-32475121 CGGCACGTGCGCTGGGGCCGCGG + Intergenic
1136858631 16:33681125-33681147 GGGAGCGGGTCCCGGGGCCGGGG + Intergenic
1137267978 16:46884361-46884383 CGGCGCGGGCGCCGGGCGCGGGG + Exonic
1139496939 16:67326774-67326796 CGGCGCGCGCGCGGGGGGCGGGG + Intergenic
1139676971 16:68530356-68530378 CGACGCGCGCCCCTCGACCGCGG - Intronic
1139750828 16:69107820-69107842 CGGCGGGCTCCCCGGGACGGTGG + Intronic
1140462166 16:75148667-75148689 CTCCGCGCGGCCTGGGGCCGAGG + Intronic
1140661043 16:77191511-77191533 CTCCGCGCCCCCGGGGGCCGGGG - Exonic
1141608858 16:85170204-85170226 CTCCGCGCGCCCCTGCGCCGAGG - Intergenic
1141959062 16:87392487-87392509 CGGCGGGTGCGGCGGGGCCGGGG + Intronic
1141972248 16:87492253-87492275 CGCGCCGCGACCCGGGGCCGGGG + Intergenic
1142156207 16:88533872-88533894 CCTCGCGCGCTCCGGGGCCCGGG - Exonic
1142188483 16:88706144-88706166 GCGCGCCCGCCCAGGGGCCGCGG - Intronic
1142335891 16:89489829-89489851 CGGGGCGGGCCTGGGGGCCGTGG - Intronic
1203016001 16_KI270728v1_random:354478-354500 CGGCACGTGCGCTGGGGCCGCGG - Intergenic
1203034336 16_KI270728v1_random:627636-627658 CGGCACGTGCGCTGGGGCCGCGG - Intergenic
1142704234 17:1684430-1684452 CGGCGCGCGGGCCGGAGGCGGGG - Intronic
1142810548 17:2393770-2393792 CGGCGCGCGCCTCACGGCCCCGG + Intronic
1142812229 17:2400727-2400749 CCGGGGGCGCGCCGGGGCCGAGG + Exonic
1142876315 17:2853715-2853737 CGGGGCGCGGCCCGGGCCGGCGG - Intronic
1143211568 17:5191865-5191887 CGGTGCGCTCCCCGGGACTGCGG + Intronic
1144500853 17:15786244-15786266 CGGGGGGCGGCCCGGGGCGGCGG - Intergenic
1145163014 17:20588906-20588928 CGGGGGGCGGCCCGGGGCGGCGG - Intergenic
1145265223 17:21376707-21376729 AGGCGCGCGCCCCCGACCCGTGG + Exonic
1145291711 17:21551671-21551693 CAGCGCATGCCCCGGGGTCGGGG + Exonic
1145815737 17:27793769-27793791 CAGCCCCCGCCCCGGGGGCGGGG + Intronic
1146052831 17:29566870-29566892 CGGCGCGCCCCCAGGGTCCCCGG + Exonic
1146251160 17:31345455-31345477 CGGGGCTCCCTCCGGGGCCGCGG + Intronic
1146322658 17:31859008-31859030 GGGCGGGGGCCGCGGGGCCGGGG - Intronic
1146371098 17:32266021-32266043 CGGCGCGGGGACCGGGGCCATGG + Intergenic
1147139590 17:38453789-38453811 CCGCCCGCCCCCCGGAGCCGCGG - Intronic
1147420096 17:40318305-40318327 CGCCCCGCGCCCCTGAGCCGCGG + Intronic
1147429543 17:40363032-40363054 GGGCGCACGGCTCGGGGCCGGGG + Exonic
1147683985 17:42276215-42276237 CGGGGCGAGCCCTGGGCCCGGGG - Intronic
1147994762 17:44354548-44354570 CGGCGCCCGCCTCGCCGCCGAGG + Exonic
1148013358 17:44503461-44503483 CTGCGCGCGCCCGGTGGGCGTGG - Intergenic
1148081055 17:44967910-44967932 CGGTCCGCGCGCCGGCGCCGGGG + Exonic
1148183105 17:45620672-45620694 CGGGGGGCGGGCCGGGGCCGCGG + Intergenic
1148265746 17:46225019-46225041 CGGGGGGCGGGCCGGGGCCGCGG - Intronic
1148818271 17:50346111-50346133 GGGCGCGCGCCCCGCGTCCCGGG + Exonic
1149626355 17:58083352-58083374 CGGCGCGCGCGGCGGGGGGGCGG + Intergenic
1150562042 17:66302732-66302754 CGGCCCGCGCCCCGCGCCCGGGG + Intronic
1151662325 17:75525534-75525556 CCCCGCGCTTCCCGGGGCCGCGG + Intronic
1151724898 17:75878140-75878162 CGACGCGTGCCCCGAGGGCGCGG - Exonic
1152362426 17:79838953-79838975 AGGCGCGGGGCTCGGGGCCGCGG - Intronic
1152362436 17:79838973-79838995 GGGCGGGGGCCCGGGGGCCGAGG - Intronic
1152403361 17:80082760-80082782 CGGCGGGGGCCCGGGGGCCTGGG - Intronic
1152468473 17:80478086-80478108 CGGCGGGCGCTCGGGGGCTGGGG - Intergenic
1152625688 17:81387019-81387041 CGGGGCGCTCCCCGGAGCTGGGG + Intergenic
1152697499 17:81804316-81804338 GGGCGGGCGCGGCGGGGCCGGGG + Intronic
1152714380 17:81891471-81891493 CGGGGCGGGGGCCGGGGCCGCGG - Exonic
1152744296 17:82031929-82031951 CCGCGTGCGCCCCGGGGTCGAGG + Intronic
1152778312 17:82215566-82215588 CGGCGGGCGCTCTGGGACCGTGG - Intergenic
1152867963 17:82735533-82735555 CGGCGCGTGACCCCGGGCGGCGG - Intergenic
1152923988 17:83079423-83079445 GGGCGCGGGCGCCGGGGCGGGGG - Intergenic
1152953040 18:11986-12008 CAGCGCGCTCCCGGGGGCAGAGG + Intergenic
1153051815 18:907737-907759 CGGCGCGCGGCGCGGAGGCGGGG - Exonic
1153900676 18:9614670-9614692 CGGGGCGCGGCCGGGGGCCCGGG - Intronic
1155507545 18:26548100-26548122 CTGCTGGCGCCCCGGGCCCGCGG - Intronic
1156099627 18:33578367-33578389 CGGCGGGCGGGCCGGGGGCGGGG - Intergenic
1157095106 18:44680213-44680235 CTCCGCGCGCCCGGGGGCCCCGG + Intronic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1157610104 18:48950614-48950636 CGGGGCGCGCGCGGGGGCCCGGG + Exonic
1157662755 18:49460277-49460299 CGGCCAGCGCCCCGGGGCGGCGG - Intronic
1157752936 18:50194729-50194751 AGGGAGGCGCCCCGGGGCCGGGG - Intronic
1157815913 18:50729491-50729513 CGGCGCGCCCCCCACGGCCACGG + Exonic
1158579815 18:58671568-58671590 CGGAAGGTGCCCCGGGGCCGAGG + Exonic
1158954273 18:62524037-62524059 CTGCGCGCGGCCCGGGGCGAGGG + Exonic
1159045553 18:63366573-63366595 CGGCGCGCGGCCCCGGGCGGGGG - Intronic
1160256233 18:77250601-77250623 CGGCCCGGGCTCCGGGGCGGGGG - Exonic
1160453403 18:78979974-78979996 CAGCGCGCGCCCCGGTCCCGAGG + Intergenic
1160453447 18:78980165-78980187 CGGCGCGGGGCGCGGGGCGGCGG - Intergenic
1160454844 18:78992956-78992978 CGGCGCTGGCGCCGGGGCGGGGG - Exonic
1160577333 18:79864104-79864126 CGGCGCGCGCCCTGGGACCTCGG + Exonic
1160624282 18:80192451-80192473 CGGCGGGAGCCCAGGGGACGGGG + Intronic
1160624296 18:80192488-80192510 CGGCGGGAGCCCAGGGGACGGGG + Intronic
1160691433 19:462048-462070 CGGCGCCGCCCGCGGGGCCGGGG + Intergenic
1160719196 19:590076-590098 GGGCGCGGGCCCGGGGCCCGGGG - Exonic
1160719296 19:590340-590362 CGGGGCCCGCGCCGGGGCCGGGG + Exonic
1160791635 19:926154-926176 GGGCGCGCGCCCCGCGCCTGGGG - Intronic
1160823022 19:1067115-1067137 GGGGGCGCGGCCCGGGGCTGGGG + Intronic
1160830870 19:1104418-1104440 AGGCGCGCGTGCCGGGGCCGGGG + Intronic
1160863991 19:1249292-1249314 CCACGCCCTCCCCGGGGCCGCGG + Intronic
1160864291 19:1250271-1250293 CGGCGCGCGCTGGGGGGCTGGGG - Exonic
1160887046 19:1354968-1354990 CGCCGCTCCCCGCGGGGCCGGGG - Intronic
1160927916 19:1555896-1555918 CAGCGCGCCCACCGGGTCCGGGG + Exonic
1160930437 19:1567576-1567598 CGTCGGGGGCCCCAGGGCCGCGG + Exonic
1160930751 19:1568429-1568451 AGGCGCGCGGGGCGGGGCCGGGG + Intergenic
1160947921 19:1652153-1652175 CGGGGGGCGCCCCGCGGCCCGGG - Intronic
1160968608 19:1757581-1757603 CGGCGTGAACCCCGCGGCCGCGG - Intronic
1161203709 19:3029388-3029410 GGGCGGGTGCCCGGGGGCCGGGG - Intronic
1161251850 19:3285019-3285041 CGGGGCGGGCCCTGGGGGCGGGG - Intronic
1161265101 19:3360152-3360174 CGCCGCGCTCGCCCGGGCCGGGG - Intronic
1161364265 19:3869061-3869083 CGGCACGCGGCTCGGGGGCGGGG - Intergenic
1161461567 19:4400590-4400612 GGGGGCGCGCGCGGGGGCCGGGG - Intergenic
1161607530 19:5223060-5223082 CGGCTTGCGGCCCGGAGCCGCGG - Exonic
1161628588 19:5340226-5340248 CGGCGCCCGGCCCGGGTCCCCGG - Intronic
1161779171 19:6279798-6279820 CGACGCGGGGCCCGGGGGCGGGG - Exonic
1161779176 19:6279805-6279827 CGGCGAGCGACGCGGGGCCCGGG - Exonic
1162031148 19:7917758-7917780 CGGCGCGGGTTCCAGGGCCGCGG - Exonic
1162412986 19:10517592-10517614 CGGGGCGCGCTCCGGTGCCGCGG - Intronic
1162445071 19:10718027-10718049 GGGCGCAGCCCCCGGGGCCGGGG + Intergenic
1163427040 19:17245586-17245608 CGCCGCTCGCCCGGGGGCTGCGG + Exonic
1163438587 19:17310032-17310054 CGGCCTGGGCCCCGGGGCGGGGG + Intronic
1163681160 19:18683487-18683509 AGGCGCGCGCTCGGGGCCCGCGG - Intergenic
1163681285 19:18683934-18683956 GGGCGCGCGCGGCGGGGGCGGGG + Intronic
1163698965 19:18777665-18777687 CGGCTCAGGCCCCGGGGCTGGGG - Exonic
1164834707 19:31349722-31349744 CGGCCCCCGCCCCTAGGCCGGGG + Intergenic
1165079350 19:33298692-33298714 CGCCGCGTGCCCCGAGGCCTGGG - Intergenic
1165431388 19:35775487-35775509 CGGCGCGCGCCCCACGGGGGCGG - Intronic
1165851452 19:38852218-38852240 CCGCGCGCGGCCGGGGGCCAGGG - Intronic
1166245393 19:41522121-41522143 CTGCGCGCGCCGCAGGGACGTGG + Intergenic
1166361318 19:42254029-42254051 CCGCGCGAGCCCGGGGGCGGCGG + Intronic
1166538733 19:43592235-43592257 CGGCGCGCGTCACCGGGCCTGGG + Exonic
1166753728 19:45178125-45178147 CGGCGCTCACCCCCGGGCCGGGG + Exonic
1166762651 19:45234584-45234606 CGGCGCACGCTCCCGGCCCGGGG + Intronic
1166796410 19:45428819-45428841 CGGCGATCGCGGCGGGGCCGGGG + Intronic
1166873858 19:45885771-45885793 CGGCGCGCGGACTGGGGCCATGG - Exonic
1166882949 19:45940225-45940247 CGCCGCCCGCCCCGGCCCCGAGG + Exonic
1167045901 19:47048479-47048501 CGGCGCGGGGACCGTGGCCGGGG + Exonic
1167369571 19:49072574-49072596 CTGCGCGCGCCATGGAGCCGCGG - Exonic
1167391317 19:49196873-49196895 CGGTGAGTGCCCCGGGGCCTTGG + Exonic
1167738861 19:51312114-51312136 GGGTCCGCGCCCCGGGGCAGGGG + Intronic
1168239527 19:55082187-55082209 ACGCGCCCGCCCCTGGGCCGGGG + Intronic
924987713 2:287550-287572 CCGAGCGCGCCCGAGGGCCGGGG - Intronic
925027505 2:621281-621303 CTGCGCGCGCCCCAGGGCGGAGG - Intergenic
926027365 2:9556318-9556340 GGGCTCGGGGCCCGGGGCCGGGG - Intergenic
926095764 2:10080031-10080053 CGGGGGGCGCCACGGGGCTGGGG + Exonic
927125991 2:20012702-20012724 CGGGGCGGGGCCCGAGGCCGCGG - Intergenic
927168737 2:20350848-20350870 CTGCGCGCGCCCGGTGGGCGGGG - Intronic
927215850 2:20667441-20667463 CGGCGCGCGGCGCGGGCCCGGGG - Exonic
927893008 2:26764220-26764242 AGGCGCGCTCCCCGGGGGCGGGG + Intergenic
928518325 2:32064136-32064158 CGGCACCGGCGCCGGGGCCGAGG - Exonic
928904376 2:36355479-36355501 CGGCTCTGGCCCCGGCGCCGCGG - Intergenic
929452905 2:42048412-42048434 CCGCGGGGGCCCCGGGCCCGGGG + Exonic
929681291 2:43995803-43995825 CGCCGCTCGCGCCGGGCCCGTGG - Exonic
931052303 2:58428479-58428501 CGGCGGCCGCCCCGGGCCCGCGG - Intergenic
931355819 2:61537426-61537448 CGGCGGGCGGGCCGGGGGCGCGG - Intronic
931671589 2:64653420-64653442 CGGGGCCCGGACCGGGGCCGCGG + Intronic
932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG + Intronic
933667156 2:84972176-84972198 CGGCGAGGGCACCAGGGCCGCGG - Intronic
933751179 2:85602774-85602796 GGGCGCGGGCACCGAGGCCGGGG - Intronic
933791827 2:85889098-85889120 GGCCGCGCGCCCGGGGGCGGGGG - Intergenic
933847459 2:86337410-86337432 GCGCGCGCAGCCCGGGGCCGGGG + Intronic
933847583 2:86337816-86337838 CTGCGCGCTCCCCGGGGCACCGG + Intronic
934716985 2:96550137-96550159 CGGCGGGCGCCCCCTGGCGGCGG - Intronic
934933217 2:98445121-98445143 CGCCGCGGGGGCCGGGGCCGGGG + Intronic
935692682 2:105745082-105745104 CGGCGCGGGTCCCGGGGCGGTGG - Exonic
936412974 2:112276281-112276303 CGGAGCCCGCCCGGGGGGCGGGG - Intronic
937084015 2:119158730-119158752 CAGAGCGCGCCGCGGAGCCGGGG - Exonic
937221678 2:120345935-120345957 CGGCGCGCCCCTCGGGCCCCCGG + Intergenic
937284536 2:120741744-120741766 CCCCGAGCGCCCCGGGCCCGCGG + Intronic
938397841 2:130963936-130963958 GGGCGCGCGAGCCCGGGCCGGGG - Intronic
938496729 2:131801759-131801781 CGGCGCGCTCCCGGGGGCAGAGG - Intergenic
940316875 2:152335753-152335775 CGCCGCCCGGCCCGGGGCCCCGG - Intronic
942098554 2:172556192-172556214 CGGCGCGCAGCCCCGGGCCCGGG - Exonic
942446140 2:176080241-176080263 CGGCGGGGGCGCCGGGGCCGGGG - Exonic
942454611 2:176129574-176129596 CTCCGTGTGCCCCGGGGCCGCGG - Intergenic
942681375 2:178480718-178480740 CTGCGCGCGCCGCAGGGACGTGG - Exonic
942748630 2:179264359-179264381 CTGCGCGGGCCGCGGGGCGGAGG - Intronic
944221651 2:197310201-197310223 CGGCCCGGGCCCCGGGGAGGAGG - Intronic
946341702 2:219073756-219073778 CCGCCCGCTCCCCGGGGCTGGGG - Intergenic
946966468 2:225042395-225042417 GGAGGCGCGCCCCGGGCCCGCGG - Exonic
947435457 2:230068518-230068540 CCGCGCGCGCCGCGGGCCTGGGG - Intronic
947625137 2:231614243-231614265 CGAGGCGCGCTCCGGGGCGGGGG + Intergenic
947800937 2:232928215-232928237 GGGCGCGCGCGGCGGGGGCGAGG + Intronic
947860502 2:233354486-233354508 CAGCGCGCGCACCGCGGGCGGGG - Exonic
948206923 2:236167417-236167439 CGGCGCGCGCAGCCGGGACGAGG - Intronic
948216551 2:236237356-236237378 CGGGGCGGGGGCCGGGGCCGGGG + Intronic
948216566 2:236237381-236237403 CGGGGCGGGGGCCGGGGCCGGGG + Intronic
948216581 2:236237406-236237428 CGGGGCGGGGGCCGGGGCCGGGG + Intronic
948468621 2:238163884-238163906 CGCCCCTGGCCCCGGGGCCGCGG + Exonic
948801507 2:240435529-240435551 CGGGGCGCGGCGCGGGGGCGCGG - Intergenic
948824790 2:240568909-240568931 CGGCGCGGGCCCCGGCCCGGGGG - Exonic
948824856 2:240569122-240569144 CGGGGCGGGCGCCGGGGCTGCGG + Intronic
1168795880 20:610027-610049 CGGCGCGGGCCCCGTGGTGGTGG - Exonic
1169211332 20:3767667-3767689 CGGGGTGCACCCCGGGGCCGGGG + Exonic
1172100699 20:32483004-32483026 CGGCGCGCACCCCGGGAGTGGGG + Intronic
1172146735 20:32762698-32762720 AGGTGAGCGCCCCGGGGCCCCGG + Exonic
1172702900 20:36863607-36863629 CCGGGCGCGCTCCGGGGGCGCGG - Exonic
1172919961 20:38473028-38473050 CGGCGCCCGCCCCGGCGATGCGG + Exonic
1173691753 20:44966437-44966459 CGGCGCGCGGCGCGGGAGCGGGG - Intergenic
1173827602 20:46057644-46057666 CGGCGAGGGCTCCGGAGCCGCGG - Exonic
1174204151 20:48827396-48827418 CAGCGCGCGCCGCGGGGAAGTGG + Intronic
1174246884 20:49188246-49188268 AGGCGGGCGCCGCCGGGCCGGGG + Exonic
1174287728 20:49484078-49484100 CTGCAGGCGCCGCGGGGCCGGGG + Intergenic
1174658521 20:52191530-52191552 CAGTGCGCGCTCCGGGGCCCGGG - Intronic
1174736900 20:52973240-52973262 CAGCGCGCGGCTCGGGGCTGGGG + Exonic
1174804154 20:53592631-53592653 CGGCGCGCGCCCCGCGTGCCGGG + Intronic
1174873993 20:54208223-54208245 CGGCGTGGGACCCGAGGCCGAGG + Intronic
1175847196 20:62065276-62065298 CGGGGCCGGGCCCGGGGCCGGGG + Exonic
1175847420 20:62065932-62065954 GGGCGCGCGGCCGGGGGGCGGGG + Intergenic
1175847476 20:62066124-62066146 GGGCGCGGGCGCCGGGGCGGTGG + Intergenic
1175847581 20:62066443-62066465 CGCAGCGCGCCCTGGGGACGGGG + Intergenic
1176118035 20:63441692-63441714 CTGAGCGTGCCCCGGGGCCCAGG - Intronic
1176128959 20:63488207-63488229 CGGCGCGCGGGGCGGGGGCGGGG + Exonic
1176194523 20:63831131-63831153 CGGCGCCGGCCCGGCGGCCGCGG - Intronic
1176311850 21:5154762-5154784 CAGCGCGCGCGCCCGGGACGGGG + Intergenic
1176547574 21:8208352-8208374 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1176548057 21:8209887-8209909 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176550024 21:8217030-8217052 CGGCGGCCGCCGCGGGGCCCCGG + Intergenic
1176555479 21:8252559-8252581 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1176555950 21:8254097-8254119 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176566525 21:8391399-8391421 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1176566988 21:8392922-8392944 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176574401 21:8435586-8435608 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1176574887 21:8437132-8437154 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176611013 21:8986878-8986900 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1176611502 21:8988428-8988450 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1178610241 21:34073498-34073520 CGGGGCGCGCCGAGGGGGCGTGG + Intronic
1178843670 21:36157100-36157122 CGGCGCGCGGCCCGGGCCTGCGG + Intronic
1179133620 21:38660755-38660777 CGGAGTGCGCGCCGGGGGCGGGG + Intronic
1179511824 21:41878820-41878842 CGGCGGGGGCCGCGGGGCCGCGG + Exonic
1179810152 21:43865097-43865119 CGGCGCGCGCGGGGCGGCCGAGG - Intergenic
1179845199 21:44107273-44107295 CAGCGCGCGCGCCCGGGACGGGG - Exonic
1179968043 21:44818143-44818165 AGGCGCGCTCCCCGGGGCGTCGG + Intronic
1180614905 22:17120695-17120717 CGGCGGGGGCGCCGCGGCCGGGG - Exonic
1181085157 22:20436477-20436499 CGGCCCCCGCCCCGGAGGCGGGG + Intronic
1182124058 22:27803896-27803918 CCCCGCCCGCCCCGGGGCCTAGG + Intergenic
1182236995 22:28883781-28883803 GGGCGGGCGCCCAGGGGCCACGG + Exonic
1182586341 22:31346154-31346176 CGGGGCGCGCACGGGGGCGGTGG + Exonic
1183228152 22:36564294-36564316 GGGCGCGGTCCCCGGGGGCGGGG - Exonic
1183393797 22:37560562-37560584 CTCCGCGAGCCCCGGGGGCGCGG - Exonic
1183650908 22:39152766-39152788 GGGGGCGGGCCCCGGGGGCGGGG - Intergenic
1183702213 22:39457237-39457259 CGGCGGGCGCGCGGGGGGCGCGG - Intergenic
1184035257 22:41915000-41915022 CGGAGGCCGCGCCGGGGCCGCGG + Intergenic
1184086919 22:42270735-42270757 CGGGGCGCGCGGCGGGGGCGGGG + Intronic
1184523001 22:45007086-45007108 GGGCGCGCGGCCGGGGGCGGGGG + Intronic
1184712832 22:46263166-46263188 CGCCGCGCACCCCGAGGCCCGGG + Exonic
1184785318 22:46668750-46668772 GGGCGGGCGCCGCAGGGCCGGGG - Intronic
1185351760 22:50343294-50343316 GGGCACGCGCTCCGGGGGCGGGG - Intronic
1185375555 22:50481393-50481415 CGGCGACCGGCCCGGGACCGCGG - Intergenic
1203252447 22_KI270733v1_random:124637-124659 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1203252936 22_KI270733v1_random:126187-126209 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1203254914 22_KI270733v1_random:133356-133378 CGGCGGCCGCCGCGGGGCCCCGG + Intergenic
1203260504 22_KI270733v1_random:169723-169745 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1203260991 22_KI270733v1_random:171268-171290 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1203262970 22_KI270733v1_random:178435-178457 CGGCGGCCGCCGCGGGGCCCCGG + Intergenic
949559478 3:5188326-5188348 GGGCGCGCGGCCCCGGGCGGCGG - Intronic
949896005 3:8768115-8768137 CGCCGCGCCGCCGGGGGCCGAGG - Exonic
949987860 3:9553815-9553837 CGGGGCGCGCTCCCGCGCCGAGG + Intergenic
950729832 3:14947775-14947797 TGGCGGGAGCCCGGGGGCCGCGG - Intronic
952382897 3:32818215-32818237 CGGCGGGGGCCCTGGGGCGGCGG + Exonic
952816635 3:37452605-37452627 CGGCGCTGGCCTGGGGGCCGGGG - Intronic
953657078 3:44862267-44862289 CCGCCCGCGGCCCGGGGCCCCGG - Intronic
953797394 3:45995847-45995869 CGGCGTGCTCCCCGGGGCTGAGG + Intergenic
954575111 3:51671523-51671545 CAGGGCATGCCCCGGGGCCGTGG + Exonic
954632826 3:52056372-52056394 GCGCGGGCGGCCCGGGGCCGGGG + Exonic
955818797 3:62874855-62874877 CGGCGCCGGCGCCGGAGCCGGGG - Exonic
956080149 3:65549093-65549115 CGGCCCGCGCCCCGGAGCGCAGG - Intronic
958004294 3:87792778-87792800 CCTCCCGCGCCCCGGGGCTGGGG + Intergenic
958638514 3:96776798-96776820 CGGCGTGCGCGGCGGGGCAGGGG - Intergenic
958641532 3:96813496-96813518 CGGCCCCCGCCCCAGGGCCGGGG - Intergenic
958779426 3:98522990-98523012 CGGGCCGCGGCCCGGGGCCGAGG + Intronic
961446306 3:126983265-126983287 CGGGGCGCGCCCCGGGGCGGCGG + Intergenic
961827553 3:129606804-129606826 CGCCGCGCAGCCCGGGGGCGGGG + Exonic
962808877 3:138945712-138945734 GGGCGCGGGCGCCGGGGGCGCGG + Exonic
966808752 3:183825618-183825640 CGGGGCGGGCCGCGGGGGCGGGG - Intergenic
966911481 3:184562467-184562489 CGGCGCCCGCTCCGGGGCCCAGG + Intronic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
967858501 3:194135018-194135040 GTGCGCGCGCCCCGGGGGCAGGG - Intergenic
967924140 3:194633225-194633247 GGGCGCGCGGCGCGGGGCCGGGG + Exonic
968178119 3:196568818-196568840 CGGCGGACGCCCCCGGGCAGGGG + Exonic
968178171 3:196568989-196569011 CGGCGCCGGCCCCGGGGGCTGGG + Exonic
968831350 4:2934320-2934342 CGGGGCGCGGGCCGGGGCTGGGG - Exonic
969344731 4:6563632-6563654 CGGCGGGCGCGGCGGGGGCGCGG + Intergenic
969368665 4:6716437-6716459 CGGGGCGCGGCCCGAGGTCGAGG + Exonic
969647493 4:8440990-8441012 CTGCGCTAGTCCCGGGGCCGCGG - Exonic
970195635 4:13547773-13547795 CTGCGCGCCCCCGAGGGCCGGGG - Intergenic
975689400 4:76949574-76949596 AGGGGCGAGCCCCGCGGCCGGGG + Intergenic
979278102 4:118835851-118835873 CGGCGCCCGGCCCGGGGACGCGG - Intronic
979546938 4:121950707-121950729 CGGCTCGCGCCCCGGCGCGCGGG - Intronic
983923448 4:173371290-173371312 CGGCGCGGGCACCGGGGCTGAGG + Exonic
984639261 4:182144526-182144548 GGCCGCGCGGCCCGGGGACGCGG - Intronic
984667840 4:182448263-182448285 CCGCGCTCGCCCCTGGGCCTCGG - Intronic
984801809 4:183722998-183723020 AGGCGGGCGCCCTGGGGCTGGGG + Intergenic
985068403 4:186144876-186144898 CCGGGCGCGCCCGGGGTCCGCGG - Exonic
985472379 5:53929-53951 AGGGGCGGGCCCGGGGGCCGGGG + Intergenic
985660700 5:1155503-1155525 CGCCGCGCGCTCCGGGGACCTGG - Intergenic
985896292 5:2751559-2751581 CGGCCCGCGGGCCGGGGCGGCGG + Exonic
985995619 5:3595647-3595669 GGGCGCGCGCGTCGGGGCGGCGG - Intergenic
986297201 5:6449251-6449273 AGGCGAGCGCGCCGGGGCTGGGG + Intronic
986330521 5:6713658-6713680 CGGGGCGGGCGCGGGGGCCGCGG - Intergenic
987379909 5:17275546-17275568 CGCCGCCCGCAGCGGGGCCGGGG - Exonic
990412220 5:55552596-55552618 CGGGGCTCCCTCCGGGGCCGCGG - Intergenic
990954650 5:61330945-61330967 CGCCGCGCACCCGGGTGCCGGGG + Intergenic
991435921 5:66596871-66596893 CGGCGGGCGCCCGGGCGCCCAGG - Exonic
992052795 5:72956342-72956364 CGCTGCGGGCCCCCGGGCCGCGG - Intronic
992828188 5:80569873-80569895 TGGAGCGCGCCCCGGGGTGGCGG + Intronic
996717712 5:126601104-126601126 CTGCGCGCTCCCCGGGGCCCAGG - Intronic
998018989 5:138753866-138753888 TGCCGCGCGCGCCGAGGCCGCGG - Intronic
998118985 5:139561175-139561197 CGTCACGCCCTCCGGGGCCGTGG + Exonic
999129485 5:149271938-149271960 CGGCCCGCTCCCCGGGGACCGGG + Exonic
999300114 5:150485880-150485902 CGGTGAGCGCCCCGGGGCGGGGG - Intronic
1001462134 5:171925084-171925106 CGGAGCGCGGCCCTGGGCAGGGG + Intronic
1002055827 5:176597468-176597490 CAGCGCCCCCGCCGGGGCCGCGG - Exonic
1002580921 5:180209075-180209097 CGGTGCGAGCCTCGGCGCCGCGG + Intronic
1002898002 6:1390184-1390206 CGGCGCGGGCGCCGGGAGCGGGG + Exonic
1002926972 6:1610411-1610433 CGGCGGGCGGCGCGGGGCGGCGG + Exonic
1003158789 6:3618251-3618273 CAGCGCGGGCCCCAGTGCCGGGG + Intergenic
1003290838 6:4776821-4776843 CGGGGGGCGGCCCGAGGCCGGGG - Intronic
1003911496 6:10747777-10747799 CGCGCTGCGCCCCGGGGCCGCGG - Exonic
1003995574 6:11537399-11537421 GGGCGCGCGCCCGGGGTCCGGGG + Intergenic
1004044726 6:12012570-12012592 CGGCGCGGGCTCCGCGGCGGGGG + Intronic
1004216780 6:13711248-13711270 CGGCGGGGGCGGCGGGGCCGCGG + Exonic
1004216922 6:13711731-13711753 GGGCGCGCGGCCCGGGGACGAGG + Intergenic
1004627915 6:17393906-17393928 CGGCGCGGGCGCGGGGGCCGGGG + Intronic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1007625390 6:43243629-43243651 CGGCGCATCCCCCGGGGCCGGGG - Intergenic
1007631434 6:43275430-43275452 CCGCCCCCGCCCCGGGGCCAGGG - Intronic
1007656856 6:43455674-43455696 CCCGGCGCGCCCCGGGGCCCCGG + Intronic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1011983835 6:93418598-93418620 CGGCGCGCGACCCGAGGGCCGGG - Intronic
1013033673 6:106360558-106360580 CGCCGCGCGCCCCCGGGGTGGGG + Intergenic
1014272264 6:119348774-119348796 CGGGGCGCGCGCCGAGGACGCGG - Exonic
1015024927 6:128520735-128520757 CGGCGCGGGGCGCGCGGCCGGGG - Intergenic
1015149273 6:130020000-130020022 CGGCGGCCGCGCCGGGGCGGCGG + Intronic
1016657940 6:146543361-146543383 CTGAGCCCCCCCCGGGGCCGGGG - Intergenic
1016658086 6:146543783-146543805 CGCCGCGCCCCCGGCGGCCGCGG - Exonic
1016658119 6:146543895-146543917 CGGCGGCCGCCCCCAGGCCGGGG - Exonic
1017880595 6:158560187-158560209 GGACGCGCGGGCCGGGGCCGAGG + Intronic
1018969732 6:168517920-168517942 CGGAGCGCGAGCCTGGGCCGGGG + Intronic
1019279573 7:193044-193066 CTGCACGCGGCCCGGGCCCGGGG + Exonic
1019395726 7:816736-816758 AGGCGGGGGCCCGGGGGCCGGGG + Intronic
1019399402 7:843467-843489 CGACACGGGCCCGGGGGCCGCGG - Exonic
1019473392 7:1232958-1232980 GGGGGCGCGGGCCGGGGCCGGGG - Exonic
1019474373 7:1236832-1236854 CGGCGCGGGCGGCGGGGGCGCGG - Exonic
1020125536 7:5530844-5530866 CGGCGCGCGCCCCCAGCCCCCGG - Intronic
1020796809 7:12686842-12686864 CGGCGCGCGGGCAGGGGGCGGGG + Intronic
1021600268 7:22357183-22357205 CGGCGCGCGCCAATGGGCAGCGG - Intergenic
1022018575 7:26376696-26376718 GGGCGGCCGCGCCGGGGCCGGGG + Intergenic
1022106338 7:27200139-27200161 GAGCGCGCGGCGCGGGGCCGGGG + Intergenic
1022275784 7:28854264-28854286 CGGTGCCCGTGCCGGGGCCGCGG + Intergenic
1022396249 7:29989879-29989901 CGGCGGGGCCCCGGGGGCCGGGG - Intronic
1022739664 7:33109155-33109177 CGTCCCGCGCCCCGGGCCCCTGG + Intronic
1024043827 7:45574474-45574496 CCGCCCGCGCCCCGGCGCCCCGG + Intronic
1025615690 7:63114349-63114371 CCGCGCACGCCCAGGGGCTGGGG + Intergenic
1026968593 7:74454706-74454728 CAGCCCCCTCCCCGGGGCCGGGG - Intronic
1027138240 7:75639299-75639321 CGCAGCGCGCGCCGGGGGCGGGG + Intronic
1027138290 7:75639439-75639461 CCGTGCGAGCCCGGGGGCCGCGG - Intronic
1027960510 7:84940026-84940048 CGGCGCCTCCTCCGGGGCCGGGG + Intergenic
1029461211 7:100694586-100694608 GGTCGCGCGTCGCGGGGCCGGGG - Intergenic
1029701394 7:102248819-102248841 CGGCGCGGAGCTCGGGGCCGCGG - Exonic
1032151697 7:129434676-129434698 CGCCGAGGGCTCCGGGGCCGAGG - Intronic
1032159936 7:129502516-129502538 CGGCGTGCGCCTCGGGGGCGGGG - Exonic
1032298796 7:130668390-130668412 CGGGGCGCGCGCGGGCGCCGGGG + Intronic
1032306117 7:130733799-130733821 CGCCGCCCGCGCCGGGGCTGGGG + Exonic
1033288589 7:140062650-140062672 CACCACGCGCTCCGGGGCCGCGG + Exonic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1034441212 7:151086852-151086874 CGGCGCGGGGCCCGGGGCCGGGG + Exonic
1035023055 7:155809952-155809974 GGGCGCCCGCGCAGGGGCCGGGG - Intronic
1035203110 7:157279281-157279303 AGGGGCGCGGCCCGGGGACGCGG + Intergenic
1035403997 7:158587015-158587037 AGGCGCGCGACCCGTGGCCGGGG + Intronic
1035404333 7:158588007-158588029 AGGGGCGCGAGCCGGGGCCGGGG - Intergenic
1036454058 8:8892926-8892948 CGGGGCCTGCCCCGGGGCCGGGG - Exonic
1037589948 8:20303960-20303982 CTGCGCGGGTCCCGGAGCCGGGG + Exonic
1037820096 8:22131190-22131212 CGGCAGGCGCCCGGGTGCCGCGG - Exonic
1037822500 8:22141719-22141741 GCGGGCGCGCCCCGCGGCCGGGG + Exonic
1037826835 8:22164957-22164979 CGGCCCGCGGCCCGCGGCCCGGG + Exonic
1038808003 8:30812489-30812511 CGGCGCCCGGGCCGGGGCCGGGG - Exonic
1040471419 8:47738234-47738256 GCGGGGGCGCCCCGGGGCCGCGG + Exonic
1041107537 8:54457916-54457938 CTGCGGGCGCCCCTGGGCCGCGG - Exonic
1041108822 8:54467005-54467027 CTGCGGGCGCCCCCGGGCCGCGG - Intergenic
1041271943 8:56117707-56117729 CGGTGCGCGCCCCGGGAGCTGGG - Intergenic
1041686717 8:60651861-60651883 CGGCGCCCGGCCCGGGGAAGGGG + Intergenic
1041686858 8:60652316-60652338 CTGCGCGTGCCCAGGGGGCGGGG + Intergenic
1041906515 8:63038908-63038930 CGGCGCGCGCTAGGCGGCCGTGG + Exonic
1042217279 8:66439058-66439080 CGACGCGCGCGCCGGGGGAGAGG - Intronic
1042271500 8:66961344-66961366 CGGGGCGCACCGCGGGGCTGGGG - Intronic
1043148338 8:76682476-76682498 CGGCGCGGGCGCGGGCGCCGCGG + Intronic
1044569404 8:93700575-93700597 CAGCGCGCGCCCAGGCGCCTTGG + Exonic
1045305414 8:100952691-100952713 GGGCGGGGGCCCCGGGGCGGGGG + Intronic
1046131576 8:109974142-109974164 CGGCCAGGGCCCCGGGGCGGCGG + Exonic
1046547321 8:115668507-115668529 CCGAGCGGGCCGCGGGGCCGGGG - Intronic
1046770472 8:118112095-118112117 CTGGGCGCGCCGAGGGGCCGCGG - Intergenic
1047393730 8:124475043-124475065 CGGGGCAGGGCCCGGGGCCGCGG - Exonic
1048484183 8:134832051-134832073 CGCCCCGCGCCCCGAGCCCGAGG + Intergenic
1049194397 8:141307787-141307809 AGGCGCGCGCCCCGGGGTGGGGG + Intronic
1049616615 8:143578348-143578370 CGGGGCGCGTCACGGGGTCGGGG - Exonic
1049645486 8:143733934-143733956 CGGGGCGCGGGCCGGGGGCGCGG - Intergenic
1049714343 8:144082834-144082856 CGGCGCGAGCCCAGGGCCCTCGG - Intronic
1051079613 9:13279336-13279358 CGGCGCGCGCGCAGGGCGCGGGG + Intronic
1054798679 9:69325560-69325582 CAGCGCGGAGCCCGGGGCCGCGG - Intronic
1056475363 9:86947077-86947099 GGGTGCGGGCCGCGGGGCCGTGG + Exonic
1056992367 9:91423780-91423802 GGGCGGGCGCGCCGGGTCCGCGG + Exonic
1057490475 9:95516307-95516329 CGGGCCGCGCGCCGGGGCCGTGG - Intronic
1057758092 9:97853128-97853150 CTGCCCGCCCCCCGGGGCCCGGG - Intergenic
1059769796 9:117414665-117414687 CGGCGCCCGCGCCGGGGCCGGGG - Exonic
1060096215 9:120793151-120793173 GAGCGAGCGCCCCGGGGCCCGGG + Exonic
1060283492 9:122228885-122228907 CTGCGCGCGGGCCGGGGGCGGGG - Intronic
1060952597 9:127613107-127613129 CGCGGCGCGGCCCGGGGCGGGGG - Intronic
1061123162 9:128656628-128656650 TTGCGAGCGGCCCGGGGCCGGGG - Exonic
1061293661 9:129666032-129666054 GGCGGCGCGCCCCGGGGCCAGGG + Exonic
1062305843 9:135906945-135906967 AGGGGCGCGGGCCGGGGCCGGGG - Intronic
1062341557 9:136095716-136095738 CAGGGCGCGCGCCGGGGGCGGGG - Intergenic
1062541921 9:137045438-137045460 CGGTGCGCGTCCCGGGGTCGGGG - Intronic
1062546584 9:137066308-137066330 CGGCGGGCTCCCCGTGCCCGAGG - Exonic
1062574661 9:137200585-137200607 GGGCGCGGGGCCCGGGGCGGCGG - Exonic
1062592212 9:137279373-137279395 CGGCGCGCGCCTCGGGGCAGTGG - Exonic
1203468852 Un_GL000220v1:107788-107810 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1203469338 Un_GL000220v1:109334-109356 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1203476673 Un_GL000220v1:151760-151782 CGGCGCGCGCCTTGGGGACCGGG + Intergenic
1203477159 Un_GL000220v1:153306-153328 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1185465815 X:353837-353859 CGGGGCTCGCCCAGGGACCGGGG + Intronic
1185621490 X:1453417-1453439 CGGGGCGAGCGCCGGGGGCGGGG - Intronic
1187172918 X:16869749-16869771 CCGCCTCCGCCCCGGGGCCGAGG + Exonic
1187172999 X:16869999-16870021 GGCGGCGCGCGCCGGGGCCGCGG - Intronic
1189322574 X:40095766-40095788 CGGCGCGCGCCCTGGCGCGCGGG + Intronic
1189398949 X:40647346-40647368 CGGCGCGGGGCCCCAGGCCGGGG + Exonic
1189534517 X:41923177-41923199 CGGCGCGGGCGGCGGGGCCGGGG + Intronic
1192361708 X:70445008-70445030 GGGCGGGCGTCCCGGGGCCTCGG - Exonic
1194977322 X:100408691-100408713 TTGCGCGCGCCCCGTGGCCCCGG + Exonic
1195716844 X:107826319-107826341 CGGCGCGAGCTCCCGGGCCCCGG - Exonic
1198424030 X:136497159-136497181 CGGCGCGAGGCCCGGGGAGGCGG - Exonic
1198767149 X:140091513-140091535 CGGGGCGTGCACCAGGGCCGCGG + Intergenic
1199772635 X:150984146-150984168 GGCCGCGGGCGCCGGGGCCGAGG - Intronic
1200233526 X:154457955-154457977 GGACGCGCGCCCCAGGCCCGAGG + Intergenic
1200292511 X:154886413-154886435 CGGCCCGGGACCCGAGGCCGGGG + Exonic
1200339355 X:155382153-155382175 CGGCCCGGGACCCGAGGCCGGGG + Exonic
1200347115 X:155458540-155458562 CGGCCCGGGACCCGAGGCCGGGG - Exonic