ID: 932779543

View in Genome Browser
Species Human (GRCh38)
Location 2:74551392-74551414
Sequence AAGAGTCACAAGGACTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932779543_932779549 15 Left 932779543 2:74551392-74551414 CCATCAAAGTCCTTGTGACTCTT 0: 1
1: 0
2: 2
3: 18
4: 224
Right 932779549 2:74551430-74551452 CCACATCTGATTCATTCCTTTGG 0: 1
1: 0
2: 0
3: 26
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932779543 Original CRISPR AAGAGTCACAAGGACTTTGA TGG (reversed) Intronic
900347440 1:2216429-2216451 CAGAGACACAAGGACCTTGGAGG - Intergenic
902393486 1:16119533-16119555 AAGGGTCACAATGACCCTGAGGG - Intergenic
903697269 1:25217181-25217203 AAGAGACACCAGGAGTGTGAAGG + Intergenic
907595802 1:55718778-55718800 AAGACTCAGTAGGACTTGGAGGG + Intergenic
908030647 1:59995692-59995714 AAGAGTCAAAAGGAAAGTGAAGG - Intronic
908493375 1:64668829-64668851 CAGAGTAACTATGACTTTGATGG + Intronic
909944522 1:81648910-81648932 AAGTGTCCAAAGGACTCTGAAGG - Intronic
910055607 1:83029955-83029977 AAAAGTCCCAAGAACTATGAAGG - Intergenic
911278661 1:95895979-95896001 ACAGGTCACAAGGACTTTGCTGG - Intergenic
913367419 1:118055606-118055628 AAGAGTCACAGGAACTTTTTTGG + Intronic
915580769 1:156811899-156811921 GAGAGTCACCAGCACTTAGATGG - Intronic
916353033 1:163873910-163873932 AACAGTCCCAAGGCTTTTGAGGG - Intergenic
916757546 1:167787453-167787475 AAGAGTCTTAAGGACTAAGATGG - Intronic
918601289 1:186365527-186365549 AGGAGTCATAAGGACCTTTACGG + Intronic
918907307 1:190513588-190513610 AAAAGTCATAAGTAATTTGAGGG - Intergenic
919118635 1:193312634-193312656 AAGAGTTACGAGGGCTTTGTGGG + Intergenic
921006754 1:211101147-211101169 CAGAGCCATAAGGGCTTTGATGG - Intronic
921282426 1:213580223-213580245 AACACTCACGATGACTTTGAGGG + Intergenic
922412818 1:225392249-225392271 GAGACTCACAAGGAACTTGATGG + Intronic
924280815 1:242435217-242435239 GATACTCACAAGGGCTTTGATGG + Intronic
1063275327 10:4560848-4560870 AAGATTAAAAATGACTTTGATGG - Intergenic
1066154836 10:32663881-32663903 AATAGTGACAAGAACTTTAAAGG - Intronic
1066494260 10:35926769-35926791 AAGAGTAATGAGGACTTTGAAGG + Intergenic
1070078253 10:73159456-73159478 AAGATCCACAAGGAATTTAATGG + Intronic
1071754365 10:88520223-88520245 AAGAGTCACAGGGTATTTTAAGG + Intronic
1073171246 10:101510616-101510638 AAAACTTACAAGGATTTTGAGGG - Intronic
1074488929 10:113920730-113920752 AAGACTTAAAAGGATTTTGAGGG + Intergenic
1076352268 10:129825412-129825434 AAGGGCCACAAGGACACTGAGGG - Intergenic
1078228702 11:9418417-9418439 AAAAGTCAGAAGGATTTTGAGGG - Intronic
1079438083 11:20477979-20478001 CACAGTCACAAGAACTTTGCTGG - Intronic
1080664474 11:34323590-34323612 ACGAGACAGAAGGACTATGAAGG - Intronic
1080864690 11:36182972-36182994 AAGAAGCACAAGGAATTTAAAGG + Intronic
1081457051 11:43233880-43233902 AAGAGTCACAGGCACTTTGATGG + Intergenic
1082665137 11:55966724-55966746 AAGAGGCAGAAGAAGTTTGAGGG - Intergenic
1083215312 11:61215053-61215075 AAGATTCACAAGGACAGGGATGG + Intergenic
1083218196 11:61233882-61233904 AAGATTCACAAGGACAGGGATGG + Intergenic
1083644206 11:64163332-64163354 AAGAATCTCAAAGAATTTGAAGG - Intronic
1084326287 11:68402160-68402182 AAGAGACACAAGGCCATTAAAGG - Intronic
1085261172 11:75205494-75205516 AAAGGTCACAGGGACTTTGGTGG - Exonic
1085588005 11:77729679-77729701 CAGAGTCACAAAGTCTGTGATGG - Intronic
1087203185 11:95366555-95366577 CAGAGGCATAAGGACTGTGATGG - Intergenic
1088113910 11:106295177-106295199 ATGAGTTACAAAGGCTTTGAAGG + Intergenic
1089062353 11:115635874-115635896 AAAAGTCATAAGGTCTTGGAGGG - Intergenic
1089293851 11:117456390-117456412 AACAGACACAAGTAGTTTGATGG + Intronic
1089870750 11:121670843-121670865 GAGACTCACAAGGACTAGGAAGG - Intergenic
1089975790 11:122730362-122730384 AAGAGACCCAAGGACTTGGCCGG + Intronic
1090358455 11:126156380-126156402 AAGAGTCAAAAGGACATATAAGG + Intergenic
1091576437 12:1740852-1740874 GAGAGTGATAAGGACTGTGAAGG + Intronic
1096993787 12:55826478-55826500 AAGAGTCATAAAGACTTTTTGGG - Intronic
1098283015 12:68880445-68880467 AAGAGTAACAAGCTCTTGGAGGG - Intronic
1098352861 12:69582270-69582292 GAGGGTCACAAAGACTTTGAGGG + Intergenic
1101043519 12:100780867-100780889 AATAGTCACAAGGAATCTGTTGG + Intronic
1102656472 12:114486157-114486179 AAGATTCAAAGGGACTTTGGGGG - Intergenic
1104149852 12:126071791-126071813 ATGACTAACAAGGAATTTGAAGG - Intergenic
1104788170 12:131464619-131464641 AGGAGTCATAAGGACTTTTAAGG + Intergenic
1105610478 13:21964977-21964999 AAGGGGCACAAGGACATTGCAGG + Intergenic
1106941884 13:34788987-34789009 AAGAATCACTAGGACTTAGGAGG + Intergenic
1106986561 13:35358773-35358795 AAAAGTGCCAAGTACTTTGAAGG + Intronic
1108018226 13:46098027-46098049 AATAATCAGAAGGACATTGAGGG + Intronic
1108393952 13:49974986-49975008 TAGAGTCAAAAGGAGTCTGATGG + Intergenic
1109159486 13:58954762-58954784 AAGAGTAATAAGGAGTTTGAGGG - Intergenic
1109484104 13:62996452-62996474 AAGAGTCACAAGTGCTATGCTGG - Intergenic
1109626237 13:64978689-64978711 AAAACTTACAAGGAATTTGAAGG - Intergenic
1110686155 13:78376942-78376964 ATATGTCAAAAGGACTTTGAAGG - Intergenic
1112363436 13:98737905-98737927 AATAGTGACATGGACTGTGAAGG + Intronic
1112762786 13:102709959-102709981 GAGAGTCACAAGGCCTTTATAGG - Intergenic
1112838876 13:103550681-103550703 AAGAGTCACAAGAATATTTAGGG - Intergenic
1115907272 14:38213775-38213797 TAGAGTCACAGGGCATTTGAAGG - Intergenic
1119222282 14:72918733-72918755 GAGAGGCATAGGGACTTTGAGGG - Intergenic
1123778054 15:23600140-23600162 AGCAGTCAAAAGGACTTCGAGGG - Intronic
1123845111 15:24292151-24292173 AAGATTCACAAGGATATTAAGGG - Intergenic
1123860266 15:24458833-24458855 AAGATTCACAAGGATATTAAGGG - Intergenic
1123888638 15:24752294-24752316 AAGATTCACAAGGACATTGGAGG - Intergenic
1125210146 15:37205151-37205173 AAGAGTCACAATGACCTTGAAGG - Intergenic
1125363974 15:38893891-38893913 AAGAATAAAAAAGACTTTGATGG + Intergenic
1125970695 15:43909004-43909026 CAGAGTCAGAATGACTTTAAGGG + Intronic
1127477066 15:59344708-59344730 AAGAGTGGGAAGGACTTTGGTGG - Intronic
1127493291 15:59485049-59485071 AAGAGTGGGAAGGACTTTGGTGG + Intronic
1129623204 15:77168699-77168721 AAGATCCAAAAGGACTTGGAAGG + Intronic
1130859155 15:87871108-87871130 AAGAATTCCAAGTACTTTGAAGG + Intronic
1133519052 16:6539273-6539295 CAGAGGCACAAGGAAATTGAAGG - Intronic
1133860898 16:9594311-9594333 GAAAGACACAAGGGCTTTGAAGG - Intergenic
1134530157 16:14976173-14976195 AACAGACAGAAGGGCTTTGAGGG - Intronic
1137989518 16:53139501-53139523 AAAAGTCACAAGGGTATTGAAGG + Intronic
1138234121 16:55365950-55365972 AATAGACATAAGCACTTTGAGGG + Intergenic
1138438080 16:57017509-57017531 ATGAGTCACTGGGACTTTGGAGG - Intronic
1139653256 16:68373114-68373136 AAAAGTCACAGGGACTGTCAGGG - Intronic
1140020280 16:71231764-71231786 AAAAGTTACAAGAGCTTTGAAGG - Intergenic
1140172864 16:72625539-72625561 AAAACTTACAAGTACTTTGAAGG + Intergenic
1141140929 16:81496451-81496473 AAAAGTGAGAAGGACTTTGAAGG + Intronic
1142350285 16:89576410-89576432 AAGAGGCGCAAGGAGATTGAGGG + Intronic
1143820992 17:9562813-9562835 AAGAGTGACAACCCCTTTGAGGG + Intronic
1143998132 17:11026597-11026619 AAGAGTCAGAAAGCCTGTGAAGG + Intergenic
1145805513 17:27725528-27725550 AGGAGTCAAAATAACTTTGAAGG - Intergenic
1146227052 17:31076154-31076176 AAGAGTATGAAGGACTCTGATGG + Intergenic
1148457946 17:47821011-47821033 CAGAGCCCCAAGGACTGTGAGGG - Intronic
1149222332 17:54429408-54429430 GAGTGTGATAAGGACTTTGAAGG + Intergenic
1150709246 17:67515947-67515969 TCAAGTCTCAAGGACTTTGATGG + Intronic
1153668217 18:7385352-7385374 AAGAATGACAAGGTCTTTCATGG + Intergenic
1157009765 18:43633035-43633057 AATGTTCCCAAGGACTTTGAAGG - Intergenic
1157049801 18:44149615-44149637 AAGAGTCACTAGAACTATCATGG - Intergenic
1159229041 18:65580942-65580964 AAGAGTTACAAGGAATTTTTTGG + Intergenic
1165524658 19:36343887-36343909 ATGGGTCACAAGGGCTTTCATGG - Intronic
925178608 2:1802033-1802055 AAGACTCCCAGGCACTTTGAGGG + Intronic
925305193 2:2843346-2843368 AAGAGGCAAAAGGACTAGGAAGG - Intergenic
926678222 2:15644552-15644574 AAGAGTCACAAGTGCAGTGATGG + Intergenic
929686561 2:44040101-44040123 AAGAGTCAGTAGAACTTGGAAGG + Intergenic
930471779 2:51825052-51825074 ATGAGTCACAATGTTTTTGATGG - Intergenic
932309591 2:70729007-70729029 CAGAGTTACAGGGACTTCGAAGG + Intronic
932474822 2:71997272-71997294 AAGAGACACAAGTTCTTGGATGG - Intergenic
932779543 2:74551392-74551414 AAGAGTCACAAGGACTTTGATGG - Intronic
932901622 2:75707681-75707703 AAGAGTCTCAAGGACCTCCAGGG - Intronic
934547575 2:95231372-95231394 AAGAGTCACTGCTACTTTGAGGG + Intronic
936011708 2:108929270-108929292 AGGCGTCACAAAGACTGTGAGGG - Exonic
936696091 2:114949910-114949932 CAGAGAAACAAGGAATTTGATGG - Intronic
936715682 2:115184496-115184518 AAGAGTCACATTCGCTTTGAAGG + Intronic
936896488 2:117433647-117433669 CAGAGTGAAAAGGACTTTTAAGG + Intergenic
937026138 2:118699415-118699437 AAGAGTGAAGAGGACTTGGATGG - Intergenic
937661141 2:124430960-124430982 AATTTTCACAATGACTTTGAAGG + Intronic
939920367 2:148103248-148103270 AAGAGAAAAAAAGACTTTGATGG - Intronic
942273197 2:174297708-174297730 AATAGTAATAAGGACTGTGAAGG + Intergenic
942642571 2:178075182-178075204 AAAAGTTACTAGGACTTGGAAGG + Intronic
945062490 2:205921432-205921454 GAGAGTTTCAAGCACTTTGAAGG - Intergenic
945856769 2:215078479-215078501 AAGATTCAAAATGAATTTGAAGG - Intronic
946121476 2:217518826-217518848 AAGATTCACAAGGACTTGGTGGG + Intronic
1168758824 20:334639-334661 AAGAGTGAGAAGGACCTTGAAGG + Intergenic
1173400966 20:42725579-42725601 AAAAGTCCCTAGGACTTGGAAGG - Intronic
1174866623 20:54142555-54142577 TAGAGTCACAAGCCATTTGATGG + Intergenic
1175041993 20:56061446-56061468 AATAGTCTCAAGAACTTTAAGGG + Intergenic
1182016784 22:27047042-27047064 GAAACTCACAAGGACTTTTAGGG + Intergenic
1182995599 22:34809163-34809185 AAGAATGACAAGGAGGTTGAAGG + Intergenic
949382672 3:3463733-3463755 AAGAATGAGAAGGATTTTGAGGG - Intergenic
949689103 3:6614129-6614151 AAGAGGCAAAAGGATTTTGGAGG + Intergenic
952933549 3:38377829-38377851 CAGAGTCACAAGGTCATAGATGG + Intronic
955488649 3:59460582-59460604 AAGAGTGATATGGACTCTGAGGG + Intergenic
955567931 3:60269800-60269822 AAGTGTTACAGGAACTTTGAGGG + Intronic
957123634 3:76129609-76129631 AAGAGTCACAATGCCTTAGTGGG - Intronic
957573343 3:81977466-81977488 AAGAATCATAAGGACCTTTAAGG - Intergenic
958814763 3:98902530-98902552 TAGAGTCACAAGCAGTTTGATGG + Intergenic
959622549 3:108413828-108413850 CAGGGACACAACGACTTTGATGG + Intronic
963261838 3:143200495-143200517 AAGAAACACAACGGCTTTGAAGG + Intergenic
963265481 3:143235836-143235858 AAAATTCTCAAGTACTTTGAAGG + Intergenic
966762581 3:183430361-183430383 AAGGGTCACAAGAATTTTCAAGG + Intergenic
967268400 3:187712818-187712840 AACAGTGACAAGGACTTTTCTGG - Intronic
968340886 3:197954597-197954619 AAGAATCACATGAACTTTGGAGG - Intronic
968781839 4:2588274-2588296 AAGAGGCACCAGAACTTTCACGG - Intronic
969444880 4:7239113-7239135 AGGAGGGACAGGGACTTTGAAGG - Intronic
969719018 4:8882892-8882914 AAGTGTGAGAAGGATTTTGAAGG + Intergenic
970325950 4:14925734-14925756 AACTGTCACAAGGACTCTGTGGG - Intergenic
970721342 4:18992773-18992795 TAGACTCACAGGCACTTTGAAGG - Intergenic
971732087 4:30397409-30397431 AATAGTCATAAGAACTTTCATGG + Intergenic
971862870 4:32130873-32130895 AAAAGTCATAAGGACCTTTACGG - Intergenic
971877472 4:32324605-32324627 AAAAGGAACAAGGACTCTGATGG - Intergenic
972320637 4:37970589-37970611 AAGCTTCACCTGGACTTTGAGGG + Intronic
972853587 4:43079069-43079091 CAGTGTTACAAGGACTTTAAAGG + Intergenic
973280311 4:48353371-48353393 AATAGTCATAAGAACTTTGATGG + Intronic
974373586 4:61047995-61048017 ACGAGTCACAGGGATTTTCAAGG - Intergenic
974415894 4:61606521-61606543 AAGAGACACAAGGAGTTTAAGGG - Intronic
974960767 4:68697291-68697313 ATTAGGCACACGGACTTTGAAGG - Intergenic
976213743 4:82695897-82695919 AAGTGTCACACTGACTTTTAGGG - Intronic
976721493 4:88172939-88172961 AAGGCACACAGGGACTTTGAAGG + Intronic
978465865 4:109008267-109008289 AAGAGGGACAAGGAAGTTGATGG - Intronic
978670521 4:111243336-111243358 AAGAGTCCAGAGGACTTTTAGGG + Intergenic
982783883 4:159520620-159520642 AAAAATCACAAGGCCTTTAAAGG - Intergenic
983106773 4:163696407-163696429 AAAAGTCTCAAGGACCTTGATGG + Intronic
983917840 4:173311616-173311638 CAGAGTCACAAGGACAGTGTGGG + Intronic
984126856 4:175821073-175821095 AATTGGCACAAGCACTTTGAAGG - Intronic
984155083 4:176186618-176186640 AAGAGTTAAAGGGATTTTGATGG + Intronic
985829542 5:2218077-2218099 CAGAGTCAGGAGGACTTGGAAGG - Intergenic
986175546 5:5349210-5349232 AAGAGTTTCAAGGACTTTCAAGG + Intergenic
986409963 5:7467507-7467529 AAAAGTCATAAGAACTCTGAAGG - Intronic
987926529 5:24349668-24349690 AAGAGTTACAAAGACTGTGGAGG + Intergenic
989513704 5:42317874-42317896 AAAAGAGAGAAGGACTTTGAGGG - Intergenic
989540282 5:42610287-42610309 GAGAGTCTCAAGGACTTAGAGGG - Intronic
989731917 5:44659259-44659281 AGGGGTCACAAGGACTTTAAAGG - Intergenic
989793453 5:45436684-45436706 AACACTGACAAGGCCTTTGAAGG + Intronic
989978435 5:50612637-50612659 GGGAGTCACAAGGACCTTTAAGG + Intergenic
990764458 5:59166631-59166653 AAGTATCACATGGACTTTTAAGG - Intronic
990991159 5:61685363-61685385 ATGAGTGCCAAGGACCTTGAAGG - Intronic
994607627 5:101989542-101989564 GAGAGTCATAAGGACCTTTAAGG - Intergenic
995010361 5:107250589-107250611 AAGAATACTAAGGACTTTGATGG + Intergenic
997422822 5:133782663-133782685 AAGTGTCACAGAGAGTTTGACGG - Intergenic
997612331 5:135223915-135223937 TAAAGTCAGTAGGACTTTGATGG + Intronic
1003309698 6:4958559-4958581 TAGAGTCACAAGCACTTAAATGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1008760038 6:54843215-54843237 AAGAATTATAAGTACTTTGAGGG + Intergenic
1009913070 6:69957796-69957818 AGGTGCCACAAGCACTTTGAGGG - Intronic
1011224584 6:85092849-85092871 TAGAGTTAAAAGGACTGTGAGGG + Intergenic
1011323175 6:86119610-86119632 AAGAGTCAGAAGCTCTTTGGTGG + Intergenic
1011438468 6:87363269-87363291 AAGAGTCTCAGGGACCTTGAAGG - Intronic
1016198997 6:141384753-141384775 TAGCCTCACAGGGACTTTGATGG - Intergenic
1016395861 6:143622705-143622727 AAGGTTCACAAGGACTTTTCTGG - Intronic
1016709836 6:147156882-147156904 AAGAGTGAGAAGGACTCAGAGGG - Intergenic
1016898431 6:149076856-149076878 AAGATTTACAAGCACTTTTACGG - Exonic
1017311324 6:152981351-152981373 AAGAGTTACAAAGATTTTTAAGG - Intronic
1018188306 6:161286997-161287019 CAGAGTCACAGGGGCTTTGCAGG + Intergenic
1020977226 7:15021718-15021740 AACAGTCATAAGGACTATGTGGG - Intergenic
1021106145 7:16641920-16641942 AAGAGGCATAAGGACTTTTTAGG + Intronic
1022040675 7:26578594-26578616 AAGACTCACAAGGGATCTGAGGG + Intergenic
1022732189 7:33038462-33038484 AAGAGTGATAAGAAATTTGATGG + Intronic
1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG + Intronic
1025256220 7:57385411-57385433 ATGAGTCCCAGTGACTTTGAGGG - Intergenic
1025868603 7:65409127-65409149 AAAAGTCATATGGAATTTGAAGG + Intergenic
1028353460 7:89878592-89878614 TAGAGTAAAGAGGACTTTGATGG - Intergenic
1029642255 7:101828692-101828714 AAGAGGCACAAAGCCTATGAGGG - Intronic
1029852635 7:103480453-103480475 AAGAGCCACAAAGAGTTTTAAGG - Intronic
1031286266 7:119872082-119872104 AAAAGTCAAAAGAATTTTGAGGG + Intergenic
1031365209 7:120892615-120892637 GAGAGTCATAAGGACCTTTAAGG - Intergenic
1032427047 7:131830695-131830717 AAGAGCTACAAGGAGGTTGATGG - Intergenic
1032982696 7:137302537-137302559 AAATATCACAAGGACTTTTATGG + Intronic
1033943855 7:146689515-146689537 AAGATTCTCAAGGACGTTGGTGG - Intronic
1035067577 7:156119317-156119339 CATAGCCACAAGGAATTTGAAGG - Intergenic
1036041938 8:5094156-5094178 AAGAATGACAAGAACTTTGAAGG - Intergenic
1036513698 8:9423677-9423699 AAGAGCTGGAAGGACTTTGAGGG + Intergenic
1043053998 8:75414140-75414162 AAAAGGCACAGGGAGTTTGAGGG - Intronic
1043080146 8:75755913-75755935 AAGAGTGGGAAGGACTTTGGTGG + Intergenic
1044171812 8:89062935-89062957 AGGGGTCATAAGGACTTTTAAGG - Intergenic
1046706396 8:117457289-117457311 AAGTGTCACTGGGATTTTGATGG - Intergenic
1048171078 8:132106956-132106978 CAGAGTCATAACTACTTTGAAGG + Intronic
1050224178 9:3432314-3432336 AAGGGTCATAAGGATTTTTAAGG + Intronic
1050350117 9:4733431-4733453 GAGAGAAACAAGGACTTTGGGGG - Intronic
1050447928 9:5746290-5746312 AAGGGTCATAAGCAATTTGACGG + Intronic
1050775593 9:9256206-9256228 AAGAGTGACAATGACATTGCTGG + Intronic
1050974236 9:11916315-11916337 AAGGCTGACAAGGTCTTTGATGG - Intergenic
1052728842 9:32262076-32262098 AAGAGTATTAAGCACTTTGAAGG - Intergenic
1053409484 9:37906321-37906343 AGGAGGCAAAAGGACCTTGAAGG - Intronic
1054941560 9:70748499-70748521 AAGAGTCAATATGAATTTGAAGG - Intronic
1054972165 9:71100670-71100692 TAGAGGCACAAGGATTCTGATGG - Intronic
1055229204 9:74041191-74041213 AAGAGACACTAGGAGTTTTACGG + Intergenic
1057092442 9:92271043-92271065 AAGTATCATCAGGACTTTGAAGG - Exonic
1058048751 9:100385228-100385250 AAGAGTAACAGGAACTCTGATGG + Intergenic
1058990044 9:110246774-110246796 AAGAGGCACAAGGACAGTAATGG + Intronic
1060514469 9:124257459-124257481 AAGAGTCGCTGGCACTTTGAGGG + Intergenic
1061949192 9:133926735-133926757 CAGAGTGACAGGGACTTTGGTGG - Intronic
1185539731 X:892686-892708 AAGTGTCACAAAGACCTTCAGGG - Intergenic
1187006587 X:15238896-15238918 AGGAGTCAAAAGGTCTTGGAGGG + Intronic
1188551217 X:31366767-31366789 AAGATACAAAAGGACATTGAAGG - Intronic
1194509872 X:94780604-94780626 AAGAAAAACAATGACTTTGAAGG + Intergenic
1196075408 X:111570058-111570080 AAAAGCCACAAGGACTTTCTTGG + Intergenic
1196234533 X:113262897-113262919 AAGAGTAAAGAGGACTTTGTTGG - Intergenic
1196288579 X:113912788-113912810 CAGTGTCACAAATACTTTGAGGG + Intergenic
1197553390 X:127923027-127923049 AACAGACACAAGGGCCTTGAAGG + Intergenic
1202261575 Y:22975800-22975822 AAGAGTCACAAAGCTTTGGAAGG + Intronic
1202414563 Y:24609541-24609563 AAGAGTCACAAAGCTTTGGAAGG + Intronic
1202456222 Y:25060545-25060567 AAGAGTCACAAAGCTTTGGAAGG - Intronic