ID: 932780208

View in Genome Browser
Species Human (GRCh38)
Location 2:74554634-74554656
Sequence CCCCCAGCGGCTGCCGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 263}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780190_932780208 19 Left 932780190 2:74554592-74554614 CCACCATTCCTTCTCGCTCCTCT 0: 1
1: 0
2: 2
3: 63
4: 834
Right 932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG 0: 1
1: 0
2: 0
3: 29
4: 263
932780191_932780208 16 Left 932780191 2:74554595-74554617 CCATTCCTTCTCGCTCCTCTCCC 0: 1
1: 0
2: 17
3: 365
4: 1893
Right 932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG 0: 1
1: 0
2: 0
3: 29
4: 263
932780192_932780208 11 Left 932780192 2:74554600-74554622 CCTTCTCGCTCCTCTCCCTCACC 0: 1
1: 0
2: 105
3: 259
4: 1761
Right 932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG 0: 1
1: 0
2: 0
3: 29
4: 263
932780196_932780208 -10 Left 932780196 2:74554621-74554643 CCCCACCGCGACCCCCCCAGCGG 0: 1
1: 0
2: 0
3: 8
4: 147
Right 932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG 0: 1
1: 0
2: 0
3: 29
4: 263
932780189_932780208 29 Left 932780189 2:74554582-74554604 CCGGGGGTCTCCACCATTCCTTC 0: 1
1: 0
2: 2
3: 27
4: 230
Right 932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG 0: 1
1: 0
2: 0
3: 29
4: 263
932780194_932780208 -4 Left 932780194 2:74554615-74554637 CCCTCACCCCACCGCGACCCCCC 0: 1
1: 0
2: 6
3: 64
4: 795
Right 932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG 0: 1
1: 0
2: 0
3: 29
4: 263
932780193_932780208 1 Left 932780193 2:74554610-74554632 CCTCTCCCTCACCCCACCGCGAC 0: 1
1: 0
2: 2
3: 47
4: 665
Right 932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG 0: 1
1: 0
2: 0
3: 29
4: 263
932780195_932780208 -5 Left 932780195 2:74554616-74554638 CCTCACCCCACCGCGACCCCCCC 0: 1
1: 0
2: 7
3: 190
4: 1681
Right 932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG 0: 1
1: 0
2: 0
3: 29
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780208 Original CRISPR CCCCCAGCGGCTGCCGGCGG GGG Exonic
900175653 1:1290330-1290352 CCTCCACCCTCTGCCGGCGGGGG + Exonic
900181052 1:1311152-1311174 CCCCCAGTTGCTGCCGTCAGTGG - Intronic
901433862 1:9234670-9234692 GCCCCGGCGGCCGCCAGCGGAGG + Intergenic
901614829 1:10530433-10530455 CCCCTAGCCGGAGCCGGCGGAGG - Intronic
901879553 1:12185842-12185864 CCCCCTGAGGCTGCAGGCTGGGG - Intronic
903652366 1:24929914-24929936 CCCCCGGGGGCGGCCGGCGCGGG + Intronic
903786387 1:25863905-25863927 CCCCCAGCTGCTGCTCGTGGGGG - Intronic
904783000 1:32964593-32964615 GCCGCAGCGGCGGCCGGCGCCGG - Exonic
905174026 1:36125203-36125225 CCCCTCGCGGCTGCCGGAGTGGG + Exonic
905352405 1:37356707-37356729 CCCCCAGCTGCTGCAGGTGAGGG + Intergenic
907442925 1:54489574-54489596 CCCCTAGGGGCCGCCGCCGGAGG + Intergenic
908326305 1:63027350-63027372 CCCCCAGGAGCTGGCGGAGGAGG + Intergenic
912698946 1:111861829-111861851 CCCACAGAGGCTGCTGGAGGCGG - Intronic
914001719 1:143699944-143699966 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914514565 1:148362851-148362873 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914993349 1:152517326-152517348 CACCCAGCAGCTGGCGGCTGAGG + Intronic
916666924 1:166975339-166975361 CACCCCGCGGCAGCGGGCGGCGG + Intronic
919841749 1:201614367-201614389 CCCGCAGCAGCTGCCGGGGTTGG - Intergenic
921472722 1:215567713-215567735 CCCGCGGCGGCGGCCGGCAGCGG + Exonic
922279907 1:224114044-224114066 TCCCCGGCGGCTGCAGGAGGAGG + Intergenic
923191771 1:231626892-231626914 GCCCCAGCCGCCGCCGGCGGCGG + Exonic
924058344 1:240145307-240145329 CCCCCAGCGGCGGCCCTCAGCGG - Intronic
1063418108 10:5889890-5889912 CCCCCAGGGGCTGGAGGCTGGGG - Exonic
1065024207 10:21526069-21526091 TCCCCCGGGGCTGGCGGCGGGGG - Intergenic
1065140377 10:22714095-22714117 CCCGCAGCAGCTGCAGCCGGAGG + Intronic
1065588863 10:27245965-27245987 TCCACAGAGGCAGCCGGCGGAGG - Intergenic
1065778465 10:29144282-29144304 CCCACACAGGCTGCCGGCTGTGG - Intergenic
1069504905 10:68989048-68989070 CGCCCTGGGGCTGCCGGCTGAGG + Exonic
1069760906 10:70810357-70810379 CCCCCAGGTGCTGCAGGCAGGGG + Intergenic
1072107855 10:92291184-92291206 CGCCGAGTTGCTGCCGGCGGAGG - Exonic
1073136835 10:101224874-101224896 CCCCCCGCGGCTCCCGGTGCGGG - Intergenic
1073143218 10:101262388-101262410 TCCCCAGAGGCTGCGGGAGGCGG - Intergenic
1074484045 10:113855220-113855242 CCCCAAGCGGCCACCGACGGGGG + Intronic
1074867038 10:117550760-117550782 CCCCCGGCAACTCCCGGCGGCGG - Intergenic
1075206866 10:120456458-120456480 CCCCAAGCTGCTGGGGGCGGAGG + Intergenic
1075430394 10:122375115-122375137 CCCTCAGCGGCGCCCGGCGGGGG + Intronic
1076747159 10:132520174-132520196 CCCCCAGGGGCTGCAGTGGGGGG - Intergenic
1076998614 11:311203-311225 CCCCTGGCGGCGGCCGGCGCAGG + Intronic
1077000129 11:318556-318578 CCCCTGGCGGCGGCCGGCGCAGG - Intergenic
1077198820 11:1295328-1295350 CCTCCTCCAGCTGCCGGCGGGGG + Intronic
1077217462 11:1400904-1400926 GGCCCAGTGGCTGCCGGCGGCGG + Intronic
1079126374 11:17720918-17720940 CCCCGAGCGGCGCCCGGCGGCGG + Exonic
1080283836 11:30586197-30586219 CCCCCAGCCCCAGCCTGCGGCGG - Intronic
1081575571 11:44316857-44316879 CCTCCAGCGGGCGCGGGCGGCGG - Intergenic
1081776499 11:45679181-45679203 CCCCCAAGGGCTGCCTGCAGAGG + Intergenic
1081831507 11:46119970-46119992 CGCCCCGCGGCCGCCGGCGGCGG + Intronic
1084785368 11:71438826-71438848 CCCCCAGAGCCTGCCGGCATCGG + Intronic
1084965353 11:72741604-72741626 CCCCCAGCGGGAGCAGGAGGGGG + Intronic
1086690768 11:89787075-89787097 CCCCCAACCGCTCCCGGCAGGGG - Intergenic
1086715032 11:90052584-90052606 CCCCCAACCGCTCCCGGCAGGGG + Intergenic
1090699199 11:129279292-129279314 GCCCCCGCGGCTGCCCTCGGCGG - Intronic
1091262522 11:134245643-134245665 ACACCAGCGGCTGGGGGCGGGGG + Exonic
1091601464 12:1920529-1920551 CCGCCAGCGGCTGGGGGAGGAGG - Intergenic
1091602191 12:1924688-1924710 CTCCCAGCGGCTGCCTGCCTGGG - Intergenic
1094495683 12:30987978-30988000 CTCCCTGCGGCTGCAGGCTGGGG + Intronic
1094536555 12:31326427-31326449 CCCCCCCCGGCTGCAGGCCGCGG + Intronic
1096298057 12:50400859-50400881 GCCGCAGCGGCTGACGGCAGGGG + Intronic
1096389584 12:51218086-51218108 CCCCCGGCGGCTGGCGCGGGCGG - Intergenic
1098029055 12:66235420-66235442 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
1102370873 12:112381834-112381856 CTCCCGGCGGCTGCCGGGGCAGG - Intronic
1102453317 12:113056970-113056992 CCCCCAGCGGGAGCCGGGGGTGG - Intronic
1103900920 12:124303321-124303343 ACCCCAGCGGCTCCCGGGGAAGG + Intronic
1104674783 12:130705087-130705109 CCCCCAGAGGCAGCCGGTGCTGG - Intronic
1104881689 12:132075835-132075857 CCCCCAGCAGCTGCCCACGCTGG + Intronic
1105034504 12:132908914-132908936 AGCCCGGCGGCTGCCGCCGGAGG + Intronic
1107168686 13:37314294-37314316 CCCCCAGCGGCTCCAGGGGAAGG + Intergenic
1107468383 13:40668448-40668470 CCCCTAGCGGCTGTCAGAGGAGG - Intergenic
1108095260 13:46894257-46894279 CCCCAAGCGGGTGACGCCGGGGG + Intronic
1108706395 13:52992290-52992312 CAAACAGAGGCTGCCGGCGGAGG - Intergenic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1113647773 13:112011189-112011211 CCACCAGCGTCTGCTGGAGGAGG + Intergenic
1116821707 14:49633864-49633886 TCTCCAGCTGCGGCCGGCGGAGG + Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119483350 14:74973524-74973546 CCCCCAGCTGCTGGCTGCGCAGG - Intergenic
1122108759 14:99480797-99480819 CCCCCAGGCGGTGGCGGCGGTGG + Exonic
1122152211 14:99731350-99731372 CCCCCAGTGACTGCCGGGGAGGG - Intergenic
1122183352 14:99971502-99971524 ACCTCAGCGGCCGCGGGCGGAGG + Intronic
1122226839 14:100285402-100285424 CCTCCTGCGGCCGGCGGCGGCGG - Intergenic
1122486636 14:102086688-102086710 CCCCCAGCGGGGCCGGGCGGGGG + Intronic
1122624162 14:103075669-103075691 CCCTCGGCGGCCGCGGGCGGAGG - Intergenic
1122786482 14:104166514-104166536 CCGGCAGCGGCTGCAGGTGGGGG + Intronic
1123468896 15:20535671-20535693 CCAGCAGCAGCTGCAGGCGGAGG - Exonic
1123649160 15:22465019-22465041 CCAGCAGCAGCTGCAGGCGGAGG + Exonic
1123729171 15:23130654-23130676 CCAGCAGCAGCTGCAGGCGGAGG - Exonic
1123747339 15:23328140-23328162 CCAGCAGCAGCTGCAGGCGGAGG - Intergenic
1124279700 15:28351993-28352015 CCAGCAGCAGCTGCAGGCGGAGG - Intergenic
1124302998 15:28559615-28559637 CCAGCAGCAGCTGCAGGCGGAGG + Intergenic
1125674645 15:41495559-41495581 CACCCAGCACCTGGCGGCGGGGG - Intronic
1128877596 15:71215037-71215059 CCCGCAGCGGATGGCGGCGGAGG + Exonic
1129814621 15:78540706-78540728 CCCCCGACGGCGGCCGGCGGGGG - Intronic
1129814622 15:78540706-78540728 CCCCCGCCGGCCGCCGTCGGGGG + Intronic
1129856853 15:78830902-78830924 CTCCCAGCGGCTGCCGGTGTTGG + Intronic
1130002505 15:80059752-80059774 TCACCGGCGGCTACCGGCGGCGG + Exonic
1130335285 15:82952704-82952726 CCGCCCGCGCCTGGCGGCGGTGG - Exonic
1130411693 15:83653710-83653732 CCCAGTGCGCCTGCCGGCGGCGG + Intergenic
1131827187 15:96331219-96331241 CACCCAGCGACTGCGGGCGGCGG + Exonic
1132055837 15:98649688-98649710 CCCGCAGTGGCCGCGGGCGGCGG - Intronic
1132868806 16:2106467-2106489 CCCCCAGCGGCGGGCGGTTGGGG + Exonic
1132896598 16:2232250-2232272 GCCCCAGCCCCTGCTGGCGGGGG - Exonic
1132898078 16:2238259-2238281 ACCCCTGCTGCTGCCTGCGGTGG - Intronic
1133188364 16:4116063-4116085 CCCCCAGCGCCCGCCGCCGCGGG - Exonic
1133219827 16:4315422-4315444 CCCCCTGCGGCCCCGGGCGGCGG - Exonic
1133270508 16:4608972-4608994 CTCCCAGCGCCTGCCTGCTGGGG - Exonic
1134522781 16:14926192-14926214 CCCCCAGCGGCGGGCGGTTGGGG - Intronic
1134549847 16:15133864-15133886 CCCCCAGCGGCGGGCGGTTGGGG + Intronic
1134710451 16:16324843-16324865 CCCCCAGCGGCGGGCGGTTGGGG - Intergenic
1134718622 16:16369131-16369153 CCCCCAGCGGCGGGCGGTTGGGG - Intergenic
1134949153 16:18343802-18343824 CCCCCAGCGGCGGGCGGTTGGGG + Intergenic
1136557460 16:31016125-31016147 CCCCCACCGGCTGGGCGCGGTGG - Intergenic
1136933458 16:34437685-34437707 CCCCCGGCTGCTGCGGGCTGTGG + Intergenic
1136971114 16:34974129-34974151 CCCCCGGCTGCTGCGGGCTGTGG - Intergenic
1139472369 16:67185042-67185064 CCCGCAGCTGCTGCTGGCTGAGG - Exonic
1139546749 16:67653224-67653246 CCCCCGGCGGCGGGCGGTGGTGG - Exonic
1141682695 16:85553638-85553660 CACCGAGCTGCTGGCGGCGGCGG + Intergenic
1141989689 16:87602779-87602801 CCCCGCGGGGCTGCCGGCGAGGG + Intronic
1142182739 16:88679146-88679168 CCCTCAGGGGCTGCAGGCTGAGG - Intronic
1144500951 17:15786468-15786490 GCGCCTGCGGCTGACGGCGGCGG + Intergenic
1144909903 17:18672499-18672521 CCCCCAGCCGCCCCCGGCTGCGG + Intronic
1145197590 17:20908434-20908456 CCCGCAGCGGCTGGAGCCGGAGG + Intergenic
1148124331 17:45229184-45229206 CCCCCAGCGGCTGAAGGGGGTGG - Intronic
1148262218 17:46193486-46193508 GCCGCAGCCGCAGCCGGCGGAGG - Intronic
1148616503 17:49004299-49004321 CCCTCACCGGCTGCGGGCTGCGG + Intronic
1149658414 17:58322373-58322395 CCTCCAGCTGCTGCCGCCGCTGG + Exonic
1150420231 17:65027431-65027453 CCCCCAGTGGCTGCTTGTGGTGG - Intronic
1151660681 17:75516537-75516559 CGCGCAGCGGCAGGCGGCGGCGG + Exonic
1151696592 17:75721252-75721274 CCCCGATCGGCTAGCGGCGGGGG - Intergenic
1151780372 17:76240976-76240998 CCCTCAGCGTCGGCCGGCGGAGG + Intergenic
1152060255 17:78067874-78067896 CCCCCAGGAGCTGCAGGAGGAGG - Exonic
1152517319 17:80833295-80833317 CCCCCAGCAGCTGGGGGCAGAGG - Intronic
1152540510 17:80972104-80972126 CCCCCAGCAGCTGCTGAAGGTGG - Intergenic
1153201754 18:2655125-2655147 CCCCCAGAGGGTGCGGGGGGCGG + Intergenic
1154012721 18:10589359-10589381 CCTCCCGCGGCGGGCGGCGGCGG - Intergenic
1155633736 18:27925709-27925731 CCACCAGGGCCTGCCGGGGGTGG - Intergenic
1156366913 18:36438028-36438050 CCTCCAGAGGCTGCCTGCAGGGG + Intronic
1156448623 18:37254116-37254138 CCGCCAGCGCCTGCCCCCGGAGG - Intronic
1157163277 18:45334848-45334870 CCCCCAACGCCTGCTGGCGGAGG + Intronic
1157272949 18:46290567-46290589 CCCTCAGAGGCAGCCAGCGGGGG + Intergenic
1159415898 18:68149039-68149061 CCACCAGCTGCTGCTGGGGGAGG - Intergenic
1160790653 19:921798-921820 CACCTAGCGGCCGCCGGCGCTGG + Intergenic
1160798221 19:955365-955387 GCCCCAGCTGCTGGCGGGGGAGG - Intronic
1160833392 19:1113531-1113553 CCCCCAGCGGGTGGCGGAGGTGG - Exonic
1161006781 19:1941161-1941183 CCGCCAGCGTCTGCCAGCGGGGG - Exonic
1161087209 19:2340695-2340717 CCCCCAGCGCCTGCCCGGGTCGG + Intronic
1161306619 19:3572595-3572617 CTCCCAGCCGCTGCCGGATGGGG - Intronic
1161491809 19:4566524-4566546 CGCCGAGCGGCTGCTGGCAGAGG - Intergenic
1161628410 19:5339757-5339779 CCCCCGGGGGCTGCGGGGGGAGG - Intronic
1161673018 19:5624578-5624600 CCCCCAGCCCCTGCAGGCAGTGG + Intronic
1161736672 19:5995833-5995855 CCCCCAGCAGCTCCCAGAGGCGG - Intronic
1161802682 19:6424643-6424665 CCCCCGCCGGCGGGCGGCGGCGG + Exonic
1162034941 19:7933625-7933647 CCTCCTGCGGCTGCAGGCAGGGG + Intronic
1162312413 19:9914743-9914765 GGCCCAGCGGCTGCCGCCGCCGG - Intronic
1163321339 19:16576767-16576789 CCACCAGCGGCTGGCGGGGCCGG - Exonic
1163465996 19:17469046-17469068 CCCCCAGGCGCTGCCAGCGCTGG - Intronic
1163552615 19:17974049-17974071 CCCCCGGGGGCTGCCGGGTGAGG - Exonic
1165236785 19:34428362-34428384 CCCCCACCCGCTTCCGGCCGCGG + Exonic
1166982602 19:46639804-46639826 CCCCCAGCTTCTGGCCGCGGTGG - Intergenic
1167049724 19:47070995-47071017 CCCCCACCCGCTGCCCTCGGAGG + Intronic
1167124450 19:47539652-47539674 CCCCCAGCAGCTGCGGGCAGTGG + Intronic
1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG + Exonic
1168719096 19:58545047-58545069 CCCCGAGCTGTTGGCGGCGGCGG - Exonic
924987054 2:281609-281631 CCTCCAGCAGCAGCCAGCGGAGG + Intronic
925984960 2:9207553-9207575 CCCCGGGCGGCGGCGGGCGGCGG - Intronic
926095785 2:10080100-10080122 CCGCCGGCGGGTGCCGGTGGCGG - Exonic
926268179 2:11344667-11344689 GCGCCGGCGGCTGCGGGCGGAGG - Intronic
926285182 2:11482609-11482631 CCCCTAGCGGCGGCCGGCGATGG - Intergenic
928611068 2:32993069-32993091 CCCACAGCAGCTGGCAGCGGGGG + Intronic
929539590 2:42810002-42810024 CCCCCAGTGGCGGCTGGCGGGGG - Intergenic
931487344 2:62706153-62706175 CCCCCAGCGGAGACAGGCGGTGG - Intronic
931711037 2:64989249-64989271 CCGGCGGCGGCTCCCGGCGGCGG + Intronic
932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG + Exonic
933847419 2:86337255-86337277 CCGCAAGCGGCCGCCGGCGCCGG + Intronic
934063891 2:88321727-88321749 GCCACAGGGGCTGCTGGCGGGGG - Intergenic
937221249 2:120344394-120344416 CCCAGAGCGGCAGCCGCCGGCGG + Intergenic
940038041 2:149330494-149330516 CCGGCCGCGGCTGCGGGCGGCGG + Intronic
941020971 2:160407661-160407683 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
942043845 2:172087780-172087802 CCCCCGTGGGCTGACGGCGGCGG + Intronic
943646134 2:190408863-190408885 CCCACAGCTGCTGCCGCGGGTGG + Intronic
944069962 2:195657437-195657459 CCCGCAGCTGCTGCAGTCGGCGG + Intronic
944433216 2:199659346-199659368 CCCCCAGCCGCCGCCGGGCGCGG + Intergenic
946246020 2:218387874-218387896 CCCCGAGCTGCTGCAGGCGGTGG + Exonic
948148146 2:235723971-235723993 GGCCCAGCGGCTGCCTGCGAGGG + Intronic
948379387 2:237542137-237542159 CCCCCAGCTGCTGTGGGAGGAGG + Intronic
948438002 2:237967024-237967046 GCCGCACCGGCTCCCGGCGGCGG - Intronic
948903372 2:240966953-240966975 CCCCCTGGGGCTGGCAGCGGTGG - Intronic
948940148 2:241191318-241191340 CCCCCAGGGGCAGCAGGCTGGGG + Intronic
948983720 2:241508054-241508076 CCTCCTGGGGCTGCTGGCGGAGG - Exonic
949042245 2:241854722-241854744 CCCCGAGGGGCTGCCTGCGGTGG - Intronic
1168757284 20:326149-326171 CCTGCAGCAGCTGCCAGCGGCGG - Exonic
1169143697 20:3239384-3239406 GGCCCAGCAGCTGCGGGCGGCGG - Intergenic
1170150508 20:13221729-13221751 CCCGGCGCGGCGGCCGGCGGCGG - Intergenic
1171995797 20:31730397-31730419 CCCCCTGCGGCTGGGCGCGGTGG + Intergenic
1174806587 20:53608773-53608795 CTCCCAGCGGCTGAGGGCGGCGG - Intronic
1175339590 20:58219767-58219789 CCCCCAGCAGCTGTCTGCAGAGG + Intronic
1175902755 20:62366588-62366610 TCCCCACCGGCAGCAGGCGGCGG + Intronic
1175931090 20:62494057-62494079 GCCCCAGCGGCTGCAGGAGCAGG - Intergenic
1175945279 20:62555715-62555737 CCTCCAGCCGCTGCAGGAGGGGG - Intronic
1176077411 20:63254632-63254654 CCCCCAGGGGCCGCAGGCGGGGG - Intronic
1176510522 21:7744739-7744761 ACCCCAGCGGCTCCCCGCCGGGG + Intergenic
1178644635 21:34375268-34375290 ACCCCAGCGGCTCCCCGCCGGGG + Intergenic
1179402373 21:41096076-41096098 TCCCCAGCAGCTGGCGGGGGTGG + Intergenic
1180199301 21:46215139-46215161 CCCCCAGGGGCTGCAGTCAGAGG + Intronic
1182619514 22:31611231-31611253 CCAGCAGCAGCTGCCGGTGGTGG - Exonic
1183616146 22:38946962-38946984 CCCCCAGCTGCTGCTGGGGAAGG + Intergenic
1183662526 22:39230029-39230051 CCCCCAGCTGCTGCAGGGGAAGG + Intronic
1184164784 22:42720802-42720824 GCTCCAGCGGCGGCGGGCGGCGG + Intronic
1184787702 22:46679898-46679920 GGCCCCACGGCTGCCGGCGGCGG + Intergenic
1185301634 22:50084014-50084036 GCTGCAGGGGCTGCCGGCGGAGG + Intronic
949888178 3:8712796-8712818 CCCCCAGGGGCTGCCTGGGGAGG - Intronic
950487699 3:13282742-13282764 CGCCGAGCGGCTGCGGGCCGGGG + Intergenic
950503603 3:13379359-13379381 ACCCCAGAGGCTCCCAGCGGTGG - Intronic
950703551 3:14766552-14766574 CCCTCAGGGGCAGCCGGCGAGGG + Intronic
952335770 3:32401834-32401856 CCCCGGGCTGCTGCCGGCGCTGG - Intronic
952382916 3:32818293-32818315 GGCGCACCGGCTGCCGGCGGCGG + Exonic
954025726 3:47781772-47781794 GCCGCAGCGGCGGGCGGCGGCGG - Exonic
955735569 3:62034830-62034852 CCTCCAGCAGCTGGCTGCGGGGG - Intronic
958932793 3:100225457-100225479 GCCCGAGCGGCTGCTGGGGGCGG + Intergenic
959919003 3:111850146-111850168 CCTCCAGCGGCTGGGCGCGGTGG - Intronic
961012915 3:123448133-123448155 CCCCCTGCGGGCGGCGGCGGCGG - Exonic
961459836 3:127043270-127043292 CCCCCAGATGCTGCCTGCGGTGG + Intergenic
962845702 3:139271989-139272011 GCCCCTGAGGCTGCCAGCGGGGG + Intronic
966362886 3:179148717-179148739 CTCCCAGCGTCGGCCCGCGGCGG + Intronic
968915589 4:3495791-3495813 TCCCCAGCTGCTCCCGGTGGGGG - Intronic
968975814 4:3821574-3821596 CCCTCAGAGGCTGCGGACGGTGG + Intergenic
976569788 4:86594650-86594672 CCACAAGCGGCTGCGGGCGTGGG - Exonic
977666864 4:99653110-99653132 CCCACAGCTGCTTGCGGCGGCGG + Exonic
978749675 4:112232251-112232273 CCCCCGGCGGCTGGAGGTGGCGG + Intronic
981475101 4:145180089-145180111 CCGCGAGCGGCGGCAGGCGGCGG + Intronic
981641219 4:146945767-146945789 CGCCCAGCACCTGCCGCCGGTGG - Exonic
983792415 4:171813830-171813852 CTCCCAGCCGCTGCCTGCAGAGG + Exonic
983940160 4:173529182-173529204 GCTGCAGCGGCTGGCGGCGGCGG + Exonic
985916314 5:2921452-2921474 AGCCCAGCGGCTGCAGGCTGGGG + Intergenic
992219736 5:74560069-74560091 CCCCCAGGGGCTGCCAGCGTGGG + Intergenic
993843472 5:92909885-92909907 CAGCCAGAGGGTGCCGGCGGAGG - Intergenic
995650522 5:114362881-114362903 CCCCCCGCGTCTGTCGGAGGAGG + Exonic
997505276 5:134411982-134412004 CCCGGAGCGGCGGCCTGCGGGGG + Intergenic
997749550 5:136330995-136331017 CCCCCAGCCACTGCTGGCGGGGG - Intronic
999133151 5:149299741-149299763 CCCCCAGGGGCTGCCGCAGGAGG + Intronic
999265637 5:150265104-150265126 CCCCCAGGGGCTGCCCTGGGAGG - Intronic
1002190105 5:177473476-177473498 CCGCCAGCAGCTCCAGGCGGTGG + Intronic
1003206577 6:4018503-4018525 TCCTCAGCCCCTGCCGGCGGCGG - Intergenic
1003235855 6:4294751-4294773 GCCCCAGAGGCTGCCTGCAGGGG - Intergenic
1003995660 6:11537718-11537740 CCGCCGGCGGCTGCGGGTGGAGG + Intergenic
1011281180 6:85679189-85679211 CCCCCAGCGGAGGCCGCCGGAGG + Intergenic
1013273411 6:108561614-108561636 CCCCCAGCCGCCCCCGGCTGCGG - Exonic
1014098262 6:117482865-117482887 CCCGCTCCGGCTGCAGGCGGAGG + Exonic
1015526002 6:134175655-134175677 CCCCCATGGGCAGCGGGCGGCGG + Intronic
1016386723 6:143536975-143536997 CGGCCATCGGCTCCCGGCGGCGG - Intronic
1019146870 6:169981316-169981338 GCCCCAGCGGCTGCTGGATGAGG - Intergenic
1019149868 6:169998041-169998063 CCCCCAGGGGCTCCCTGAGGTGG - Intergenic
1019492970 7:1323701-1323723 CCCCCAGCGCCAGGCGGTGGGGG + Intergenic
1019989471 7:4682010-4682032 CCCCGCGGGGCTGCAGGCGGCGG - Intergenic
1019989565 7:4682276-4682298 CTCCGAGCGGCCTCCGGCGGCGG - Intergenic
1022020911 7:26398649-26398671 CCGCCGCCGGCTGCAGGCGGAGG - Intergenic
1023881712 7:44324895-44324917 ACCCGAGCGGCAGGCGGCGGGGG - Intronic
1024505367 7:50158067-50158089 ACCCCAGAGGCTGCTGGGGGAGG - Intronic
1026236997 7:68535321-68535343 CCCTCTGCAGCTGCTGGCGGAGG + Intergenic
1027248027 7:76380211-76380233 CCCCGCGCGGCTCCCCGCGGAGG + Intergenic
1028922206 7:96321595-96321617 CCCCCAGCGCTTGCCGGCCCAGG + Intronic
1029339253 7:99929584-99929606 CCTGCGGCGGCTGCTGGCGGAGG - Exonic
1034973139 7:155431607-155431629 CACCCAGCGGCTGCATGCTGGGG - Intergenic
1037733857 8:21551105-21551127 CCCCCTGTGGCTTCCTGCGGAGG - Intergenic
1038725938 8:30082782-30082804 CCTGCACCGGCTGACGGCGGCGG + Intronic
1039426829 8:37493208-37493230 TCCCCAGTGGCTGCTGGCGGCGG - Intergenic
1044629161 8:94262311-94262333 GCCGCGGCGGCTGCAGGCGGCGG - Exonic
1047203134 8:122782609-122782631 CTCCCGGCGGCTGCAGGCAGCGG + Intronic
1049082717 8:140455997-140456019 CCGCCAGGGGCTGTCGGAGGGGG + Intronic
1049354832 8:142182492-142182514 CCCCGAGCCACGGCCGGCGGTGG - Intergenic
1049548515 8:143246034-143246056 CCCGGAGGGGCTGCCTGCGGCGG + Intergenic
1049619032 8:143589500-143589522 CTGCCTGCGGCTGCCGTCGGGGG + Exonic
1049619145 8:143589946-143589968 CGCCCAGCAGCTGCCAGCCGAGG - Exonic
1049796856 8:144500953-144500975 TCACCCGCGGCTGCCGGCGCTGG - Exonic
1056675488 9:88673427-88673449 CCCCAGGAGGCTGCAGGCGGAGG + Intergenic
1057618789 9:96617989-96618011 CCCCCCGCAGCTACCGGCCGGGG + Intronic
1057996039 9:99822277-99822299 AGCCCAGCGGCTCCCGGAGGCGG - Exonic
1058439203 9:104991735-104991757 CTCCCAGCCGCGGCGGGCGGCGG + Intergenic
1059311298 9:113390614-113390636 CCGCCAGCGGCTGGCTGAGGTGG - Exonic
1061673286 9:132201307-132201329 CACCCAGCCTCTGCGGGCGGCGG + Intronic
1062003890 9:134229864-134229886 CCCCCAGGGGCTGCCCCCGACGG + Intergenic
1062355483 9:136160126-136160148 TCTCCATCGGCTGCCTGCGGTGG - Intergenic
1062452611 9:136621875-136621897 CCACCTGCGGCGGCCGGCGCTGG - Intergenic
1062567535 9:137169957-137169979 CCCACCGCGGGTGCCGGGGGCGG - Exonic
1186638185 X:11427936-11427958 CCCCCAACAGCTGTCAGCGGCGG - Intronic
1187275157 X:17810611-17810633 CTCCCAGGAGCTGCCGGAGGAGG + Intronic
1190064096 X:47228783-47228805 CCTCCAGCCGCTGCCTGCTGGGG - Exonic
1191797391 X:65035186-65035208 CCCCCTGCGGCGGGCGGGGGAGG + Intergenic
1196854808 X:119972844-119972866 CCCCCAGCGCCTGGCGGGAGTGG - Intergenic
1197335165 X:125203691-125203713 CGCCCCGAGGCTGCAGGCGGCGG - Intergenic
1202119598 Y:21509469-21509491 CCCACAGCGGTTGCCTGGGGTGG - Intergenic
1202122051 Y:21533010-21533032 CCCACAGCGGTTGCCTGGGGTGG - Intronic
1202156956 Y:21896373-21896395 CCCACAGCGGTTGCCTGGGGTGG + Intronic
1202159402 Y:21919914-21919936 CCCACAGCGGTTGCCTGGGGTGG + Intergenic
1202185850 Y:22184829-22184851 CCCACAGCGGTTGCCTGGGGTGG + Intergenic
1202205510 Y:22401567-22401589 CCCACAGCGGTTGCCTGGGGTGG - Intronic