ID: 932780442

View in Genome Browser
Species Human (GRCh38)
Location 2:74555624-74555646
Sequence GGAGTTCTCCAGCATCTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 2, 1: 0, 2: 1, 3: 20, 4: 193}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780442_932780456 30 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384
932780442_932780453 25 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
932780442_932780447 0 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780447 2:74555647-74555669 TTGTACAGCCCTACCTGGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 100
932780442_932780445 -4 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780445 2:74555643-74555665 CTCCTTGTACAGCCCTACCTGGG 0: 1
1: 0
2: 2
3: 6
4: 104
932780442_932780444 -5 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780444 2:74555642-74555664 ACTCCTTGTACAGCCCTACCTGG 0: 1
1: 0
2: 1
3: 2
4: 77
932780442_932780452 21 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780452 2:74555668-74555690 GGTAGACGCCTCAGAAGCCCGGG 0: 1
1: 0
2: 1
3: 50
4: 154
932780442_932780451 20 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780451 2:74555667-74555689 AGGTAGACGCCTCAGAAGCCCGG 0: 1
1: 0
2: 1
3: 9
4: 93
932780442_932780454 26 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780442 Original CRISPR GGAGTTCTCCAGCATCTCCA GGG (reversed) Exonic