ID: 932780443

View in Genome Browser
Species Human (GRCh38)
Location 2:74555625-74555647
Sequence AGGAGTTCTCCAGCATCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 2, 1: 0, 2: 2, 3: 25, 4: 200}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780443_932780454 25 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136
932780443_932780452 20 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780452 2:74555668-74555690 GGTAGACGCCTCAGAAGCCCGGG 0: 1
1: 0
2: 1
3: 50
4: 154
932780443_932780451 19 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780451 2:74555667-74555689 AGGTAGACGCCTCAGAAGCCCGG 0: 1
1: 0
2: 1
3: 9
4: 93
932780443_932780445 -5 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780445 2:74555643-74555665 CTCCTTGTACAGCCCTACCTGGG 0: 1
1: 0
2: 2
3: 6
4: 104
932780443_932780444 -6 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780444 2:74555642-74555664 ACTCCTTGTACAGCCCTACCTGG 0: 1
1: 0
2: 1
3: 2
4: 77
932780443_932780456 29 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384
932780443_932780453 24 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
932780443_932780447 -1 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780447 2:74555647-74555669 TTGTACAGCCCTACCTGGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780443 Original CRISPR AGGAGTTCTCCAGCATCTCC AGG (reversed) Exonic