ID: 932780446

View in Genome Browser
Species Human (GRCh38)
Location 2:74555645-74555667
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780446_932780459 19 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780459 2:74555687-74555709 CGGGCAGGGATGGAGTGAAGAGG 0: 1
1: 0
2: 4
3: 61
4: 686
932780446_932780460 22 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780460 2:74555690-74555712 GCAGGGATGGAGTGAAGAGGAGG 0: 1
1: 0
2: 7
3: 84
4: 1084
932780446_932780452 0 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780452 2:74555668-74555690 GGTAGACGCCTCAGAAGCCCGGG 0: 1
1: 0
2: 1
3: 50
4: 154
932780446_932780453 4 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
932780446_932780461 25 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780461 2:74555693-74555715 GGGATGGAGTGAAGAGGAGGAGG 0: 1
1: 1
2: 16
3: 190
4: 1776
932780446_932780451 -1 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780451 2:74555667-74555689 AGGTAGACGCCTCAGAAGCCCGG 0: 1
1: 0
2: 1
3: 9
4: 93
932780446_932780462 26 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780462 2:74555694-74555716 GGATGGAGTGAAGAGGAGGAGGG 0: 1
1: 1
2: 17
3: 177
4: 1708
932780446_932780454 5 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136
932780446_932780456 9 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780446 Original CRISPR TTCCCAGGTAGGGCTGTACA AGG (reversed) Exonic