ID: 932780448

View in Genome Browser
Species Human (GRCh38)
Location 2:74555655-74555677
Sequence GGCGTCTACCTTCCCAGGTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 57}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780448_932780452 -10 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780452 2:74555668-74555690 GGTAGACGCCTCAGAAGCCCGGG 0: 1
1: 0
2: 1
3: 50
4: 154
932780448_932780463 22 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780463 2:74555700-74555722 AGTGAAGAGGAGGAGGGCCGAGG 0: 1
1: 0
2: 4
3: 59
4: 671
932780448_932780456 -1 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384
932780448_932780464 23 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780464 2:74555701-74555723 GTGAAGAGGAGGAGGGCCGAGGG 0: 1
1: 0
2: 0
3: 39
4: 516
932780448_932780465 30 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780465 2:74555708-74555730 GGAGGAGGGCCGAGGGCCTTTGG 0: 1
1: 0
2: 1
3: 27
4: 375
932780448_932780454 -5 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136
932780448_932780461 15 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780461 2:74555693-74555715 GGGATGGAGTGAAGAGGAGGAGG 0: 1
1: 1
2: 16
3: 190
4: 1776
932780448_932780462 16 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780462 2:74555694-74555716 GGATGGAGTGAAGAGGAGGAGGG 0: 1
1: 1
2: 17
3: 177
4: 1708
932780448_932780453 -6 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
932780448_932780460 12 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780460 2:74555690-74555712 GCAGGGATGGAGTGAAGAGGAGG 0: 1
1: 0
2: 7
3: 84
4: 1084
932780448_932780459 9 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780459 2:74555687-74555709 CGGGCAGGGATGGAGTGAAGAGG 0: 1
1: 0
2: 4
3: 61
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780448 Original CRISPR GGCGTCTACCTTCCCAGGTA GGG (reversed) Exonic