ID: 932780449

View in Genome Browser
Species Human (GRCh38)
Location 2:74555656-74555678
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780449_932780465 29 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780465 2:74555708-74555730 GGAGGAGGGCCGAGGGCCTTTGG 0: 1
1: 0
2: 1
3: 27
4: 375
932780449_932780454 -6 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136
932780449_932780459 8 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780459 2:74555687-74555709 CGGGCAGGGATGGAGTGAAGAGG 0: 1
1: 0
2: 4
3: 61
4: 686
932780449_932780461 14 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780461 2:74555693-74555715 GGGATGGAGTGAAGAGGAGGAGG 0: 1
1: 1
2: 16
3: 190
4: 1776
932780449_932780456 -2 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384
932780449_932780462 15 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780462 2:74555694-74555716 GGATGGAGTGAAGAGGAGGAGGG 0: 1
1: 1
2: 17
3: 177
4: 1708
932780449_932780464 22 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780464 2:74555701-74555723 GTGAAGAGGAGGAGGGCCGAGGG 0: 1
1: 0
2: 0
3: 39
4: 516
932780449_932780466 30 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780466 2:74555709-74555731 GAGGAGGGCCGAGGGCCTTTGGG 0: 1
1: 0
2: 0
3: 17
4: 193
932780449_932780460 11 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780460 2:74555690-74555712 GCAGGGATGGAGTGAAGAGGAGG 0: 1
1: 0
2: 7
3: 84
4: 1084
932780449_932780463 21 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780463 2:74555700-74555722 AGTGAAGAGGAGGAGGGCCGAGG 0: 1
1: 0
2: 4
3: 59
4: 671
932780449_932780453 -7 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780449 Original CRISPR AGGCGTCTACCTTCCCAGGT AGG (reversed) Exonic