ID: 932780452

View in Genome Browser
Species Human (GRCh38)
Location 2:74555668-74555690
Sequence GGTAGACGCCTCAGAAGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780446_932780452 0 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780452 2:74555668-74555690 GGTAGACGCCTCAGAAGCCCGGG 0: 1
1: 0
2: 1
3: 50
4: 154
932780448_932780452 -10 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780452 2:74555668-74555690 GGTAGACGCCTCAGAAGCCCGGG 0: 1
1: 0
2: 1
3: 50
4: 154
932780442_932780452 21 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780452 2:74555668-74555690 GGTAGACGCCTCAGAAGCCCGGG 0: 1
1: 0
2: 1
3: 50
4: 154
932780443_932780452 20 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780452 2:74555668-74555690 GGTAGACGCCTCAGAAGCCCGGG 0: 1
1: 0
2: 1
3: 50
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780452 Original CRISPR GGTAGACGCCTCAGAAGCCC GGG Exonic