ID: 932780453

View in Genome Browser
Species Human (GRCh38)
Location 2:74555672-74555694
Sequence GACGCCTCAGAAGCCCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780442_932780453 25 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
932780443_932780453 24 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
932780446_932780453 4 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
932780449_932780453 -7 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
932780448_932780453 -6 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780453 2:74555672-74555694 GACGCCTCAGAAGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780453 Original CRISPR GACGCCTCAGAAGCCCGGGC AGG Intronic