ID: 932780454

View in Genome Browser
Species Human (GRCh38)
Location 2:74555673-74555695
Sequence ACGCCTCAGAAGCCCGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780446_932780454 5 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136
932780448_932780454 -5 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136
932780450_932780454 -10 Left 932780450 2:74555660-74555682 CCTGGGAAGGTAGACGCCTCAGA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136
932780443_932780454 25 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136
932780442_932780454 26 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136
932780449_932780454 -6 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780454 2:74555673-74555695 ACGCCTCAGAAGCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780454 Original CRISPR ACGCCTCAGAAGCCCGGGCA GGG Intronic