ID: 932780456

View in Genome Browser
Species Human (GRCh38)
Location 2:74555677-74555699
Sequence CTCAGAAGCCCGGGCAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 384}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780450_932780456 -6 Left 932780450 2:74555660-74555682 CCTGGGAAGGTAGACGCCTCAGA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384
932780449_932780456 -2 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384
932780448_932780456 -1 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384
932780443_932780456 29 Left 932780443 2:74555625-74555647 CCTGGAGATGCTGGAGAACTCCT 0: 2
1: 0
2: 2
3: 25
4: 200
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384
932780442_932780456 30 Left 932780442 2:74555624-74555646 CCCTGGAGATGCTGGAGAACTCC 0: 2
1: 0
2: 1
3: 20
4: 193
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384
932780446_932780456 9 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780456 2:74555677-74555699 CTCAGAAGCCCGGGCAGGGATGG 0: 1
1: 0
2: 2
3: 35
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780456 Original CRISPR CTCAGAAGCCCGGGCAGGGA TGG Intronic