ID: 932780459

View in Genome Browser
Species Human (GRCh38)
Location 2:74555687-74555709
Sequence CGGGCAGGGATGGAGTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 752
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 686}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780449_932780459 8 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780459 2:74555687-74555709 CGGGCAGGGATGGAGTGAAGAGG 0: 1
1: 0
2: 4
3: 61
4: 686
932780450_932780459 4 Left 932780450 2:74555660-74555682 CCTGGGAAGGTAGACGCCTCAGA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 932780459 2:74555687-74555709 CGGGCAGGGATGGAGTGAAGAGG 0: 1
1: 0
2: 4
3: 61
4: 686
932780446_932780459 19 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780459 2:74555687-74555709 CGGGCAGGGATGGAGTGAAGAGG 0: 1
1: 0
2: 4
3: 61
4: 686
932780448_932780459 9 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780459 2:74555687-74555709 CGGGCAGGGATGGAGTGAAGAGG 0: 1
1: 0
2: 4
3: 61
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780459 Original CRISPR CGGGCAGGGATGGAGTGAAG AGG Intronic