ID: 932780460

View in Genome Browser
Species Human (GRCh38)
Location 2:74555690-74555712
Sequence GCAGGGATGGAGTGAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1176
Summary {0: 1, 1: 0, 2: 7, 3: 84, 4: 1084}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780450_932780460 7 Left 932780450 2:74555660-74555682 CCTGGGAAGGTAGACGCCTCAGA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 932780460 2:74555690-74555712 GCAGGGATGGAGTGAAGAGGAGG 0: 1
1: 0
2: 7
3: 84
4: 1084
932780446_932780460 22 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780460 2:74555690-74555712 GCAGGGATGGAGTGAAGAGGAGG 0: 1
1: 0
2: 7
3: 84
4: 1084
932780448_932780460 12 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780460 2:74555690-74555712 GCAGGGATGGAGTGAAGAGGAGG 0: 1
1: 0
2: 7
3: 84
4: 1084
932780455_932780460 -9 Left 932780455 2:74555676-74555698 CCTCAGAAGCCCGGGCAGGGATG 0: 1
1: 0
2: 0
3: 20
4: 242
Right 932780460 2:74555690-74555712 GCAGGGATGGAGTGAAGAGGAGG 0: 1
1: 0
2: 7
3: 84
4: 1084
932780449_932780460 11 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780460 2:74555690-74555712 GCAGGGATGGAGTGAAGAGGAGG 0: 1
1: 0
2: 7
3: 84
4: 1084

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780460 Original CRISPR GCAGGGATGGAGTGAAGAGG AGG Intronic