ID: 932780462

View in Genome Browser
Species Human (GRCh38)
Location 2:74555694-74555716
Sequence GGATGGAGTGAAGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1904
Summary {0: 1, 1: 1, 2: 17, 3: 177, 4: 1708}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780446_932780462 26 Left 932780446 2:74555645-74555667 CCTTGTACAGCCCTACCTGGGAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 932780462 2:74555694-74555716 GGATGGAGTGAAGAGGAGGAGGG 0: 1
1: 1
2: 17
3: 177
4: 1708
932780450_932780462 11 Left 932780450 2:74555660-74555682 CCTGGGAAGGTAGACGCCTCAGA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 932780462 2:74555694-74555716 GGATGGAGTGAAGAGGAGGAGGG 0: 1
1: 1
2: 17
3: 177
4: 1708
932780455_932780462 -5 Left 932780455 2:74555676-74555698 CCTCAGAAGCCCGGGCAGGGATG 0: 1
1: 0
2: 0
3: 20
4: 242
Right 932780462 2:74555694-74555716 GGATGGAGTGAAGAGGAGGAGGG 0: 1
1: 1
2: 17
3: 177
4: 1708
932780448_932780462 16 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780462 2:74555694-74555716 GGATGGAGTGAAGAGGAGGAGGG 0: 1
1: 1
2: 17
3: 177
4: 1708
932780449_932780462 15 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780462 2:74555694-74555716 GGATGGAGTGAAGAGGAGGAGGG 0: 1
1: 1
2: 17
3: 177
4: 1708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932780462 Original CRISPR GGATGGAGTGAAGAGGAGGA GGG Intronic