ID: 932780463

View in Genome Browser
Species Human (GRCh38)
Location 2:74555700-74555722
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 671}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932780449_932780463 21 Left 932780449 2:74555656-74555678 CCTACCTGGGAAGGTAGACGCCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 932780463 2:74555700-74555722 AGTGAAGAGGAGGAGGGCCGAGG 0: 1
1: 0
2: 4
3: 59
4: 671
932780458_932780463 -9 Left 932780458 2:74555686-74555708 CCGGGCAGGGATGGAGTGAAGAG 0: 1
1: 0
2: 1
3: 42
4: 453
Right 932780463 2:74555700-74555722 AGTGAAGAGGAGGAGGGCCGAGG 0: 1
1: 0
2: 4
3: 59
4: 671
932780457_932780463 -8 Left 932780457 2:74555685-74555707 CCCGGGCAGGGATGGAGTGAAGA 0: 1
1: 0
2: 6
3: 45
4: 397
Right 932780463 2:74555700-74555722 AGTGAAGAGGAGGAGGGCCGAGG 0: 1
1: 0
2: 4
3: 59
4: 671
932780455_932780463 1 Left 932780455 2:74555676-74555698 CCTCAGAAGCCCGGGCAGGGATG 0: 1
1: 0
2: 0
3: 20
4: 242
Right 932780463 2:74555700-74555722 AGTGAAGAGGAGGAGGGCCGAGG 0: 1
1: 0
2: 4
3: 59
4: 671
932780450_932780463 17 Left 932780450 2:74555660-74555682 CCTGGGAAGGTAGACGCCTCAGA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 932780463 2:74555700-74555722 AGTGAAGAGGAGGAGGGCCGAGG 0: 1
1: 0
2: 4
3: 59
4: 671
932780448_932780463 22 Left 932780448 2:74555655-74555677 CCCTACCTGGGAAGGTAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 932780463 2:74555700-74555722 AGTGAAGAGGAGGAGGGCCGAGG 0: 1
1: 0
2: 4
3: 59
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type