ID: 932786614

View in Genome Browser
Species Human (GRCh38)
Location 2:74610436-74610458
Sequence AGGGAAACAATTTGTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 326}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932786614_932786616 -6 Left 932786614 2:74610436-74610458 CCAATGTCACAAATTGTTTCCCT 0: 1
1: 0
2: 3
3: 31
4: 326
Right 932786616 2:74610453-74610475 TTCCCTCATTTTAAGAGTCAGGG 0: 1
1: 0
2: 4
3: 29
4: 326
932786614_932786619 13 Left 932786614 2:74610436-74610458 CCAATGTCACAAATTGTTTCCCT 0: 1
1: 0
2: 3
3: 31
4: 326
Right 932786619 2:74610472-74610494 AGGGTCTTGCTCTGTTGCCCAGG 0: 3404
1: 18030
2: 59862
3: 128720
4: 207756
932786614_932786620 17 Left 932786614 2:74610436-74610458 CCAATGTCACAAATTGTTTCCCT 0: 1
1: 0
2: 3
3: 31
4: 326
Right 932786620 2:74610476-74610498 TCTTGCTCTGTTGCCCAGGCTGG 0: 19870
1: 65461
2: 149698
3: 191149
4: 205218
932786614_932786615 -7 Left 932786614 2:74610436-74610458 CCAATGTCACAAATTGTTTCCCT 0: 1
1: 0
2: 3
3: 31
4: 326
Right 932786615 2:74610452-74610474 TTTCCCTCATTTTAAGAGTCAGG 0: 1
1: 0
2: 0
3: 27
4: 348
932786614_932786621 27 Left 932786614 2:74610436-74610458 CCAATGTCACAAATTGTTTCCCT 0: 1
1: 0
2: 3
3: 31
4: 326
Right 932786621 2:74610486-74610508 TTGCCCAGGCTGGAATGCAGTGG 0: 3618
1: 75796
2: 185134
3: 229826
4: 185832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932786614 Original CRISPR AGGGAAACAATTTGTGACAT TGG (reversed) Intronic
907360622 1:53911261-53911283 AGTGAAATAATTTTTCACATTGG + Intergenic
907905434 1:58780592-58780614 AGGGAAAGAATTAATGAAATTGG + Intergenic
908149820 1:61288475-61288497 AGGAAAACAATTTTGGAAATAGG + Intronic
908171315 1:61507660-61507682 AGGGAAAAACTTCTTGACATTGG + Intergenic
909191197 1:72554592-72554614 AGAAAAACAATTTGAAACATTGG + Intergenic
909529947 1:76671079-76671101 AGGGAACCAGTATGTCACATGGG + Intergenic
910104851 1:83620818-83620840 AGGGAAACACTTCAGGACATTGG + Intergenic
910395304 1:86787381-86787403 AGGAAAAAGATTTATGACATTGG + Intergenic
910437610 1:87220935-87220957 AGGGACAGAATTTAAGACATGGG - Intergenic
910510927 1:88003078-88003100 AGGGGAACAATTTGGAGCATTGG - Intergenic
910608457 1:89113399-89113421 AGGGTGACAATTGCTGACATCGG + Intronic
911308196 1:96258136-96258158 AGGGAAACAGTCATTGACATGGG + Intergenic
911679311 1:100696055-100696077 AGGGAAACTCTTTAGGACATTGG - Intergenic
912446227 1:109739200-109739222 AGAGAGACAATAAGTGACATTGG - Intronic
913781307 1:122390800-122390822 AAGGAAACACTTTGTGACGATGG + Intergenic
914868763 1:151456531-151456553 AGGAAAAGCATTTGTGAGATTGG - Intronic
917409215 1:174741131-174741153 AGGCAAAGAATTTGTTACAAAGG - Intronic
918155120 1:181837119-181837141 GGGGAAACACTTTATAACATTGG + Intergenic
918457919 1:184743996-184744018 CAAGAAAAAATTTGTGACATTGG + Intronic
918555197 1:185790942-185790964 AGGTGCACATTTTGTGACATGGG - Intronic
919144715 1:193619426-193619448 AGGGAAACACTTCATGACATTGG + Intergenic
919873074 1:201838681-201838703 AGTGAAACAATAGGTGCCATAGG + Intronic
920858158 1:209680591-209680613 GGGGAAATATTTTGAGACATTGG - Intergenic
923376157 1:233365187-233365209 GGGGAAACAATTCAGGACATGGG + Intronic
923459877 1:234199555-234199577 GGAGAAAGACTTTGTGACATTGG + Intronic
923834933 1:237600512-237600534 GGGGAAACACTTCATGACATTGG + Intronic
924587173 1:245370241-245370263 AGGGAAACATATAGTGGCATGGG - Intronic
924898157 1:248365004-248365026 AGGGAAAAGCTCTGTGACATTGG + Intergenic
1064235446 10:13569885-13569907 AGGAAAATAATTTGTGACTAAGG + Intergenic
1064305311 10:14160351-14160373 GGGGAAACAATTCAGGACATTGG + Intronic
1064466772 10:15590957-15590979 GGGAGAATAATTTGTGACATGGG + Intronic
1067021640 10:42805077-42805099 TATGAGACAATTTGTGACATTGG - Intronic
1068482714 10:57614038-57614060 AGGGAAACACTTCAGGACATGGG + Intergenic
1069020152 10:63477677-63477699 GAGGAAACATTTTGTGACACTGG + Intergenic
1070235504 10:74621148-74621170 AGGGAAACACTTCAAGACATTGG - Intronic
1070997483 10:80798202-80798224 AGGGAACCCATTTGAGCCATGGG + Intergenic
1071132964 10:82417082-82417104 AGGGAAAGAATGAGTGACCTTGG - Intronic
1072820161 10:98548673-98548695 AGGGGAACAAGTGCTGACATAGG + Intronic
1074460502 10:113632554-113632576 AGGGACACAGTTGGTGGCATGGG - Intronic
1074463874 10:113665295-113665317 AGGTTACCAATTTGTGACCTTGG + Intergenic
1074704319 10:116117811-116117833 AGGGACACAATTTAGTACATAGG - Intronic
1074966866 10:118498653-118498675 AGGGAAAAAGTATGTGACATTGG - Intergenic
1076173812 10:128348035-128348057 GGAGAAAGTATTTGTGACATTGG - Intergenic
1076572628 10:131442572-131442594 AGGGAAACACTGTATGATATGGG - Intergenic
1076748558 10:132527936-132527958 AGGAAAAGAAATTGTGACTTCGG - Intergenic
1077450652 11:2641712-2641734 GGGGAAACACTTTAGGACATTGG - Intronic
1077673324 11:4176536-4176558 AGGGAAACACTTTAGGACTTTGG - Intergenic
1078137898 11:8667263-8667285 GGGGAAAATATTTATGACATTGG + Intronic
1080213165 11:29810492-29810514 TGGGAAACAATTTGTTTCAGTGG + Intergenic
1081120955 11:39265336-39265358 GGGGAAACACTTTATGACATTGG + Intergenic
1081178318 11:39956097-39956119 GGGGAATCATTTTGTGTCATAGG - Intergenic
1081624842 11:44647010-44647032 AGGGAAGATATTTGTGACCTTGG + Intergenic
1081824158 11:46031250-46031272 AAGGAAACAATTTCTGACACTGG - Intronic
1082864998 11:57891172-57891194 GGGGAAACACTTTATGACACTGG - Intergenic
1082897518 11:58207924-58207946 AGAGAAACACTTTGTAACATTGG + Intergenic
1084984209 11:72853390-72853412 GGGGAAACACTTTATGACACTGG + Intronic
1086260563 11:84934925-84934947 AGGCAAACAATTTGGTAAATGGG - Intronic
1086415349 11:86583877-86583899 GGGGAAAAACTTTATGACATTGG + Intronic
1087829501 11:102803747-102803769 AGGGAAAGAATCTGTGCCAAGGG - Intergenic
1088243612 11:107795380-107795402 AGGGAAACACTTTAGGACATTGG + Intronic
1088327959 11:108620501-108620523 AAGGAAACAATTTGTGAATAGGG - Intergenic
1088561873 11:111123409-111123431 ACTGAAACACTTTGTGACACTGG + Intergenic
1088722039 11:112601526-112601548 GGGGAAACTTTTTGTGGCATTGG - Intergenic
1090130729 11:124138854-124138876 AGGGAAAATATCTATGACATTGG - Intronic
1090426441 11:126610030-126610052 ACTGAAACAATGTGTGACTTCGG - Intronic
1090503241 11:127282594-127282616 AGGGACACACTTTTTGACATAGG - Intergenic
1090866811 11:130708318-130708340 GGGGAAAGGATTCGTGACATTGG + Intronic
1092077830 12:5687896-5687918 AGGGAACCAGTGTGGGACATTGG - Intronic
1092355410 12:7790769-7790791 AGGGACTCACTTTGTCACATAGG + Intronic
1093126411 12:15333858-15333880 AGGGAACCTATTTATGACTTGGG - Intronic
1093355127 12:18157678-18157700 AAGGAAATAATTTGTGAATTGGG - Intronic
1093891184 12:24523805-24523827 AGGGAAAATCTTTGTGACATCGG + Intergenic
1094556894 12:31509912-31509934 AGGGACTGAATTTGTGACACTGG - Intronic
1095852060 12:46821239-46821261 AGGGAAAAACTTTTTAACATTGG - Intronic
1096138777 12:49225143-49225165 ATGGAAACACTGTGTGACAAAGG - Intronic
1097000798 12:55874794-55874816 AAGTAAACAATTTGTGGCAGTGG + Intergenic
1097497626 12:60361097-60361119 AGGGAAAACAGTTGTGAAATTGG + Intergenic
1097644814 12:62223687-62223709 AGGGAAACATTTCATGATATTGG + Intronic
1098513456 12:71346178-71346200 AGGGAAACAGACTGTGAGATGGG - Intronic
1098812832 12:75117909-75117931 AGGGGACCAATTTGTGGTATGGG - Intronic
1099876357 12:88410765-88410787 AGTTAAACAATGTGTGACAGGGG - Intergenic
1099950679 12:89299170-89299192 GGGGAAACATTTTATGACATTGG + Intergenic
1100905702 12:99295921-99295943 AGAGAAACACTTTGTGACTTTGG - Intronic
1101562739 12:105874267-105874289 GGGAAAACAATTTAGGACATTGG + Intergenic
1101613675 12:106315326-106315348 AGGGAAGCTTTTTCTGACATTGG + Intronic
1101687459 12:107039245-107039267 AGGAAAAAGCTTTGTGACATTGG + Intronic
1104160002 12:126168866-126168888 AGGGCAACAGTTGGTGACCTGGG + Intergenic
1104328838 12:127825574-127825596 AGGGAAACAATTGGGGAGAGTGG - Intergenic
1104642285 12:130475202-130475224 AGGGAAAGCATTTGTTAAATCGG - Intronic
1106508683 13:30393910-30393932 GGGGAAACAAGATGTGAAATAGG + Intergenic
1107331874 13:39310119-39310141 AGGGGAGCAATTTCTGGCATTGG - Intergenic
1107364160 13:39652017-39652039 TGGAAAACAATATGTGAAATAGG + Intergenic
1108116950 13:47139180-47139202 AGGGAAATATTTTATGACACAGG + Intergenic
1108978950 13:56485505-56485527 ACAGAAACAATTTTTGACATGGG - Intergenic
1109704628 13:66073851-66073873 ATGGAAACAATTTGTCAGCTGGG + Intergenic
1110141377 13:72133629-72133651 ACGGGAACAATTTGTAACCTGGG + Intergenic
1110160908 13:72377558-72377580 GAGGAAAAACTTTGTGACATTGG + Intergenic
1110557108 13:76872265-76872287 AGGAAAACACTTTGTGACATGGG + Intergenic
1111137061 13:84061300-84061322 AGGAAAACAATTCAGGACATTGG - Intergenic
1111452389 13:88436169-88436191 GGGAAAAAACTTTGTGACATTGG + Intergenic
1111510346 13:89253744-89253766 AGGAAAATAATTAGTCACATGGG - Intergenic
1112080476 13:95964377-95964399 AGGCAAACACTTTTGGACATTGG + Intronic
1112679518 13:101746767-101746789 AGGGACACCATTTTTCACATTGG - Intronic
1112817441 13:103289447-103289469 AGGGAAACACTTCATGACATTGG + Intergenic
1113000014 13:105624572-105624594 TGGGAAACAATTTGATACACAGG - Intergenic
1113543646 13:111129272-111129294 AGAGAAAACATTTGTGACTTTGG + Intronic
1115401532 14:32966835-32966857 GGGGAAACACTTCATGACATTGG + Intronic
1116192476 14:41678919-41678941 AGAGAAAGAATCTGTGACCTTGG + Intronic
1116368999 14:44106160-44106182 AGGGAAAAAATTCTTGAAATTGG + Intergenic
1116403821 14:44543351-44543373 AGGGAAACAAATGGTGAGAAGGG - Intergenic
1117407344 14:55417097-55417119 AGAGAAACGATTTTAGACATAGG + Intronic
1118033750 14:61843483-61843505 AGGGAAACATTTCAGGACATTGG - Intergenic
1120312564 14:82849311-82849333 AAGGAAACACTTCATGACATTGG + Intergenic
1120626642 14:86835446-86835468 AGGGAAACATTTCAGGACATCGG + Intergenic
1120711786 14:87800035-87800057 TAGGAAACAATATGTCACATGGG + Intergenic
1122042017 14:98994942-98994964 GGAGAAACACTTTGTGACCTTGG + Intergenic
1123774172 15:23561961-23561983 AGGTAACTAATTTGTGACAGGGG + Intergenic
1123818451 15:24002571-24002593 AGGGAACCAATGTGGGAAATGGG + Intergenic
1124586358 15:31012933-31012955 AGGGAAGGAAATTCTGACATTGG - Intronic
1125279120 15:38025805-38025827 TGGGAAACAATTTGAATCATGGG + Intergenic
1125748081 15:42010954-42010976 AAGGAAAAAATTTGGGACAAGGG + Intronic
1126425338 15:48521636-48521658 ACGGAAAGAGTTTGTGGCATAGG + Intronic
1127763185 15:62161068-62161090 AGGGAAAAACTTCATGACATTGG + Intergenic
1127814413 15:62594719-62594741 AGGGAAAAGCTCTGTGACATTGG + Intronic
1130694833 15:86120627-86120649 TGAGAAACAATTTGTGCCAGTGG - Intergenic
1137912239 16:52389500-52389522 AGGGAAACACTTCATGACATTGG + Intergenic
1140226952 16:73085742-73085764 AGGGAAACACTTCAGGACATTGG + Intergenic
1145289431 17:21531458-21531480 AGGGCAACAATTTGAGCCATCGG + Exonic
1146109112 17:30071048-30071070 AGGGAAACACTTCAGGACATTGG + Intronic
1146293141 17:31627060-31627082 AGGGAAACACTTTTTGAATTAGG + Intergenic
1149014796 17:51895806-51895828 AGGAAAACAATTTCTGATTTCGG + Intronic
1150545021 17:66147593-66147615 AGGGAAAAGCTTTATGACATTGG - Intronic
1151095436 17:71492320-71492342 AGGGAACCACTTTGTTATATGGG - Intergenic
1153127589 18:1813492-1813514 GGGGAAACACTTCATGACATAGG + Intergenic
1154258437 18:12806856-12806878 AGGGAAACACTTCAGGACATTGG + Intronic
1155088399 18:22481193-22481215 GGGGAAACACTTTAAGACATCGG + Intergenic
1156730349 18:40186724-40186746 ATTGAAACAGTTTGTGAAATTGG - Intergenic
1158971245 18:62668677-62668699 AAGGAAACGATTTTTGACAATGG - Intergenic
1159132688 18:64298017-64298039 AGAGAAACACTCTGTGACATTGG + Intergenic
1159457137 18:68673724-68673746 AGGTTTACAATTTGTGCCATAGG + Exonic
1159855182 18:73578560-73578582 AGGGGAAGGCTTTGTGACATTGG + Intergenic
1160548161 18:79675719-79675741 ACGGGAAAAATTTATGACATTGG - Intergenic
925764657 2:7219830-7219852 AGGGAAACAATTTTCAACTTAGG - Intergenic
926930198 2:18030090-18030112 GGGGAAACACTTTAGGACATTGG - Intronic
927155239 2:20217527-20217549 AGTGAACCCATCTGTGACATAGG - Intronic
928051199 2:27997402-27997424 AGGGAAACATTTTATGAAGTAGG + Intronic
928378192 2:30795476-30795498 AGGGAAACAAATTAAGACATAGG - Intronic
928973080 2:37052249-37052271 AGGCAAACTATTTGTAACAGTGG + Intronic
929305077 2:40352369-40352391 AAGGTAACCATTTGAGACATTGG - Intronic
929388022 2:41434454-41434476 AGCAAAACCAGTTGTGACATTGG + Intergenic
929422694 2:41809945-41809967 GGGGAAAAACTTTTTGACATTGG + Intergenic
931186370 2:59955404-59955426 AGGGAAACAATTCAGGACATTGG + Intergenic
931772303 2:65508469-65508491 AGAGAAACTCTTTGTGACCTTGG - Intergenic
932786614 2:74610436-74610458 AGGGAAACAATTTGTGACATTGG - Intronic
932959917 2:76401078-76401100 AGGTAAAACATTTGTGTCATTGG + Intergenic
933641020 2:84760227-84760249 AGGGAAACTCTTCTTGACATTGG + Intronic
934083051 2:88485658-88485680 AGGAAAAATATTTGTGACTTTGG - Intergenic
934520852 2:95019260-95019282 AAGGACACAGTTTGTGTCATGGG + Intergenic
934881779 2:97988371-97988393 AGGGAAAAAGTTCATGACATTGG + Intronic
936979636 2:118252622-118252644 AGGGAAAAATTAGGTGACATTGG - Intergenic
938149913 2:128873532-128873554 AGGTCAAAAATTTGTGTCATTGG + Intergenic
939328124 2:140721836-140721858 AGGGAAACAATTTGCCTCAGAGG - Intronic
939841434 2:147193473-147193495 AGGGAAAAACTTCATGACATTGG + Intergenic
940104192 2:150079545-150079567 AGGGAAACATTTCAGGACATTGG + Intergenic
940220900 2:151350268-151350290 AAAGAAATAATTTGTGTCATCGG - Intergenic
940749298 2:157606890-157606912 GGGGAAACACTTCATGACATTGG - Intronic
944808035 2:203301749-203301771 AGATAAACAAATTTTGACATAGG - Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
945940846 2:215948456-215948478 AGGGACAAAATCTGTGACCTTGG + Intronic
946019158 2:216628348-216628370 TGGGAAAGAATTTGTGACTAAGG - Intergenic
946067011 2:216996604-216996626 AGGGAAACAAGTTGTGCAAACGG - Intergenic
946490146 2:220140918-220140940 AGGGAAAAGTTTTATGACATTGG - Intergenic
946519397 2:220448861-220448883 AGGGAAACAATTGGGGATAAAGG + Intergenic
946942568 2:224785117-224785139 AAATATACAATTTGTGACATTGG - Intronic
947315994 2:228859132-228859154 AGGGAAACAACTTGTAATATAGG - Intronic
947377131 2:229507836-229507858 AGGGAAACATTTTCTTAAATTGG + Intronic
947535353 2:230936964-230936986 AGGGAAACAGGATTTGACATAGG - Intronic
948713648 2:239842915-239842937 GGGGAAACACTTTGCAACATTGG - Intergenic
1169603529 20:7289917-7289939 CGGGATTCAATCTGTGACATGGG - Intergenic
1169925152 20:10775758-10775780 AGGGAAACAGCTCCTGACATTGG + Intergenic
1169991732 20:11512133-11512155 GGGGAAACAGTTTGGCACATAGG + Intergenic
1170119902 20:12900469-12900491 AGGGAATCAGTCTGTGACAATGG + Intergenic
1170242751 20:14187254-14187276 AGAGACAGATTTTGTGACATTGG + Intronic
1170392956 20:15895044-15895066 TGGAAAACAACTTTTGACATAGG - Intronic
1172985016 20:38978770-38978792 AGGGAAACACTTCATGACACTGG - Intronic
1173207028 20:41003169-41003191 ATGGAAACACTTTGTGCCTTGGG + Intergenic
1178928822 21:36799104-36799126 AGAGAATATATTTGTGACATTGG - Intronic
1179315513 21:40240590-40240612 GGGGAAGAAATTTCTGACATTGG - Intronic
1180919619 22:19514668-19514690 AAGCAAACTATTTGTGACTTTGG + Intronic
949283169 3:2370200-2370222 AGAGATAAATTTTGTGACATGGG - Intronic
949452329 3:4200052-4200074 AGAGAAAAAATTTGTGACCTTGG - Intronic
950657033 3:14443023-14443045 ATGGAAACAATATTTGAGATGGG - Intronic
951335743 3:21419426-21419448 GAGGAAACCATTTGAGACATAGG - Exonic
952519434 3:34141532-34141554 CGGGAAAAATTTTATGACATTGG - Intergenic
952995821 3:38881228-38881250 AGGGAAGCAGTGGGTGACATGGG - Intronic
955668541 3:61376779-61376801 GGGTAAATAATTTGTGACATTGG - Intergenic
956364460 3:68484913-68484935 AGGGAAACAATTTGTTTGCTGGG + Intronic
957802073 3:85098020-85098042 AGAGAATGAATTTGTGTCATAGG + Intronic
959625843 3:108449645-108449667 GGGGAAAAAGTTTCTGACATTGG + Intronic
960483682 3:118225042-118225064 AGGGAAACTATTCTGGACATTGG + Intergenic
961975478 3:131020318-131020340 AGGGAAAGTAGTTGTCACATGGG - Intronic
962154277 3:132928589-132928611 AAGGAAACCAAATGTGACATCGG + Intergenic
963011107 3:140771306-140771328 AGCAAAACAGTTTGTGAGATAGG - Intergenic
963729449 3:148957286-148957308 AGAGAAATAATTTGTAACAGAGG - Intergenic
964018834 3:151982184-151982206 AGGCTAAAAGTTTGTGACATTGG - Intergenic
964686660 3:159403461-159403483 AGAGAAAGAATTTGTGCAATAGG + Intronic
965577681 3:170234511-170234533 AGGGAAAAAATTAGTTACACTGG - Intronic
965629732 3:170720214-170720236 AGGGAAACTCTCTGAGACATTGG + Intronic
966506897 3:180714163-180714185 ATGGAAAGAATCTGTGAGATGGG - Intronic
967558415 3:190888205-190888227 AAGGAAATAATTTGAGACTTGGG - Intronic
967666099 3:192174038-192174060 AGGAAAGCAATGTGTGGCATTGG - Intronic
969979783 4:11142767-11142789 GGGGAAACAAATTGTGTCAAGGG + Intergenic
971883069 4:32407284-32407306 AGGGGAAATATTTGTGACATTGG - Intergenic
973840202 4:54853253-54853275 AGGGAACTATTTTCTGACATTGG + Intergenic
974290498 4:59923609-59923631 AGGGAAACACTTCAGGACATTGG + Intergenic
974510153 4:62829336-62829358 AGTTAAACAATTTTTGACAAAGG - Intergenic
974715256 4:65661299-65661321 AGGGAAAGAATTAGTCACAGTGG - Intronic
975070089 4:70124166-70124188 AGGGAAAACATTCATGACATTGG + Intergenic
977608639 4:99009949-99009971 GGGGAAATACTTTGTGACAATGG - Intronic
978815258 4:112897221-112897243 AGAGAAACAACTTCTGTCATGGG - Intronic
978868699 4:113548057-113548079 AGGGAAACAATTTATGTGACGGG - Intronic
979624931 4:122834141-122834163 TGGGAATCAATCTGTGAGATGGG - Intronic
980658722 4:135827442-135827464 AGGGAAACAATCAGCCACATTGG - Intergenic
980752644 4:137112006-137112028 AGAGAAACACTTCATGACATTGG - Intergenic
981143292 4:141295950-141295972 AGGGAAAGCATTTGTTACAGAGG - Intergenic
981360314 4:143838744-143838766 AGGGAAACACTTCCAGACATTGG - Intergenic
983075637 4:163322938-163322960 ATGGAAACAAGTTGTTACTTGGG - Intergenic
983101486 4:163631727-163631749 AGGGAAAAACTGTATGACATTGG + Intronic
983325037 4:166243505-166243527 AGGGAAACATTTGCTGACACTGG - Intergenic
984335589 4:178385259-178385281 AGGGAAAGATTATCTGACATTGG - Intergenic
985011116 4:185583087-185583109 AGGGAAACAATTTGTGCTGATGG + Intergenic
985163535 4:187068902-187068924 AGAGAAAATATCTGTGACATTGG - Intergenic
986578443 5:9236745-9236767 AGGGAAACACTTGGAGACAAGGG - Intronic
987238401 5:15967831-15967853 AGGGAAACAAGTCTTGACCTTGG - Intergenic
987463811 5:18248366-18248388 ATGGAAAAAATCTGTGACCTTGG - Intergenic
987630940 5:20470896-20470918 AGAGGAGAAATTTGTGACATTGG - Intronic
988300305 5:29416499-29416521 AGGAAAAAAATTTATGATATTGG + Intergenic
989322480 5:40152490-40152512 GGGGAAATGTTTTGTGACATTGG + Intergenic
989642095 5:43592763-43592785 AGGGAAACAAAATGTGCCAGTGG - Intergenic
990605033 5:57400770-57400792 GGGGAAACACTTTAGGACATTGG - Intergenic
990791033 5:59480438-59480460 AGGGAGGTAATCTGTGACATTGG - Intronic
993304412 5:86257144-86257166 AGGGAAAATATTTATGATATTGG + Intergenic
993827306 5:92707437-92707459 AGGGAAACGATCTATGGCATAGG + Intergenic
994250143 5:97526381-97526403 AGGGAAAGTATTTGTGGCAATGG + Intergenic
994314856 5:98321105-98321127 AGGGAGACATTTAATGACATGGG + Intergenic
996524467 5:124463283-124463305 AGAGAAACAATTTCTGTTATCGG - Intergenic
996607352 5:125339314-125339336 GAGGAAACACTTTGTGATATGGG - Intergenic
996740342 5:126792898-126792920 AGGGAAACAATATGAGATGTAGG + Intronic
996828694 5:127715203-127715225 GGGAAAACACTTTGTGAGATTGG - Intergenic
997960769 5:138319470-138319492 AGGGAAAAAATTCATGACACTGG + Intronic
998363068 5:141607770-141607792 AGGGAAAGAATTCATGAGATGGG - Intronic
998793281 5:145789559-145789581 AGGGAAAAAATCCATGACATTGG + Intronic
1001161715 5:169323639-169323661 AAGGAAACAATATGTAATATTGG + Intergenic
1003927570 6:10890766-10890788 GGGGAAACACTTTAGGACATTGG - Intronic
1007331346 6:41112145-41112167 AGGGATACAAATTTTCACATTGG - Intergenic
1007442166 6:41871645-41871667 TGGGAAACAATCTGTAAGATTGG + Intronic
1009194814 6:60670846-60670868 GGGGAAAATATTTGTGACCTTGG + Intergenic
1009882636 6:69587969-69587991 GGGGAAACACTTTAGGACATCGG + Intergenic
1010645117 6:78378378-78378400 AGGGAAACTCTTTCAGACATTGG + Intergenic
1011292799 6:85793951-85793973 TGGGACACAATTTGAGACACTGG - Intergenic
1012196145 6:96343162-96343184 AGGGAAATAATTTGAATCATGGG - Intergenic
1012422444 6:99079581-99079603 ATGGAAACATTTTCTGAAATAGG - Intergenic
1012679333 6:102159320-102159342 AGTGAAACTATTTTTGACAAAGG + Intergenic
1012765411 6:103361374-103361396 AGGGAAACACTTTAGGACTTTGG + Intergenic
1013467900 6:110433725-110433747 AGGGAAAAAATTTGTTAGCTTGG - Intronic
1013872889 6:114788632-114788654 GGGGAAACACTTCCTGACATTGG - Intergenic
1014043635 6:116857797-116857819 AGAAAAACCATTTGGGACATAGG - Intergenic
1014235093 6:118945094-118945116 AGAGAAACAATTTGGGTAATAGG + Intergenic
1014402064 6:121002285-121002307 GGGGAAACAATCTAGGACATTGG + Intergenic
1014587713 6:123220825-123220847 AAGGAAGCAATTTTTGAAATAGG - Intronic
1014608558 6:123511059-123511081 GGGGAAACACTTTAGGACATTGG - Intronic
1014807236 6:125843827-125843849 AGGGAACCAAATTCTCACATGGG + Intronic
1015204521 6:130619731-130619753 AGGCAAAAATTGTGTGACATGGG + Intergenic
1016458335 6:144255640-144255662 AGGGAAAATTTTTATGACATTGG - Intergenic
1018348675 6:162931402-162931424 AGGAAAAAATTTTGTGACCTTGG - Intronic
1019037310 6:169072519-169072541 AGGGAAACAATGTGGGAGAGTGG - Intergenic
1019968875 7:4524054-4524076 GTGGAAACAATTTTTGAGATAGG + Intergenic
1020654977 7:10918171-10918193 AGGTACACAGTTTGTAACATAGG - Intergenic
1020671073 7:11113109-11113131 AGGAAAACAATTTTTGAAATAGG + Intronic
1021212063 7:17866052-17866074 GGGGAAACAATCCATGACATTGG + Intronic
1021372043 7:19861202-19861224 AGGGATACAATTTTTGATTTGGG + Intergenic
1021436316 7:20620313-20620335 TGGGAAAAAATTTTTGACACTGG + Intronic
1021752854 7:23821731-23821753 AGGGAAACACTTCATGACATTGG - Intronic
1022924955 7:35047399-35047421 AGGGAGTAAATTTGTGACGTGGG + Intergenic
1023141497 7:37106691-37106713 AGGGGAACAAAGTGTGGCATTGG + Intronic
1023680833 7:42685615-42685637 AGGGAACCAATTGTTCACATAGG - Intergenic
1024432988 7:49312355-49312377 AGGTATACAATTTGAAACATTGG + Intergenic
1025966223 7:66274501-66274523 AGGGAAAAGCTCTGTGACATTGG + Intronic
1028698255 7:93743478-93743500 AGGGAGAGGATTTATGACATTGG - Intronic
1029325634 7:99806099-99806121 AAGGAAAAGATTTATGACATTGG + Intergenic
1030000993 7:105061930-105061952 AGGGAAACTATATTTGAAATTGG + Intronic
1030429946 7:109432393-109432415 AGGCAAACAATTTATGACCAAGG - Intergenic
1031457951 7:122007482-122007504 AGGAAGACATATTGTGACATGGG - Intronic
1031556319 7:123180937-123180959 AGGAAATCAACTTATGACATTGG + Intronic
1032250902 7:130256419-130256441 AAGGAATCAATTTGTGACATGGG + Intergenic
1033702094 7:143849554-143849576 GGAGAAACAATTCATGACATTGG + Intergenic
1034513102 7:151552321-151552343 AGGGAAAAACTTTGTGGGATGGG + Intergenic
1034994064 7:155566822-155566844 GGAGAAACACTTTATGACATTGG + Intergenic
1035560133 8:598111-598133 AGGGAAACAATTTGCTCCACTGG - Intergenic
1036007338 8:4681121-4681143 AAGCAAACAATTTTTGACATAGG + Intronic
1037742285 8:21617152-21617174 AGGGAAAAGCTTTGTGACAGAGG - Intergenic
1039985306 8:42442291-42442313 AGGGAAAACTTTTGTGACCTTGG - Intronic
1040846919 8:51853183-51853205 AAGGAAACAATTTTTGGCAAGGG + Intronic
1040970581 8:53132487-53132509 GGGGAAACACTTCATGACATTGG + Intergenic
1041003745 8:53479349-53479371 AGGCACACTATTGGTGACATGGG - Intergenic
1041023764 8:53663536-53663558 GGGAAAACACTTTATGACATTGG - Intergenic
1041080725 8:54212605-54212627 AGAAAAACAATTGGAGACATTGG + Intergenic
1041906756 8:63041049-63041071 TGGGAAAAACTTTATGACATTGG - Intergenic
1042811101 8:72825974-72825996 ATGGAAACCCTTTATGACATTGG - Intronic
1044259001 8:90096329-90096351 AGAAAAAAAATTTGTGGCATGGG - Intergenic
1044346765 8:91113623-91113645 AGGGAAAAACTTCTTGACATTGG + Intronic
1045559360 8:103246060-103246082 AGGGAGGCAGTTTATGACATGGG + Intergenic
1046408386 8:113805277-113805299 AGGAAAACACTTTATCACATTGG - Intergenic
1047072528 8:121362048-121362070 AGAGAAAGCATTTGTGACCTTGG + Intergenic
1050366807 9:4880313-4880335 AGGAAAACAAATTGTGAAAGGGG + Intronic
1050579418 9:7035564-7035586 AGGGAAACACTTCAGGACATTGG - Intronic
1051187260 9:14473270-14473292 AGGGATACAATTTTTGACCTGGG + Intergenic
1051552292 9:18343530-18343552 AGGGAATATATTTGTGTCATTGG + Intergenic
1051720629 9:20033513-20033535 ATAGAAATAATTTGTGACAATGG + Intergenic
1053030611 9:34774155-34774177 AGGGAAAAATTTTATGACATTGG + Intergenic
1055229685 9:74047172-74047194 GGGGAAAAACTTTATGACATTGG - Intergenic
1056272401 9:84959229-84959251 ATGGAAAGAATTTTTAACATTGG - Intronic
1058103701 9:100946125-100946147 AGAGTAACAATTCCTGACATTGG - Intergenic
1059509617 9:114832326-114832348 AGGGAAACACTTTATGACATTGG - Intergenic
1059597361 9:115736217-115736239 GGGGAAACATTTCATGACATTGG - Intergenic
1060008350 9:120020462-120020484 AGGGAGACAATTTGAATCATGGG + Intergenic
1060167148 9:121427290-121427312 AGGGAAACACTTGAAGACATTGG + Intergenic
1060381276 9:123175421-123175443 AGAGAAACAAATTGTGGCAGTGG + Intronic
1061693323 9:132353398-132353420 AGGGAAACAATTTTATCCATAGG - Intronic
1062202662 9:135313640-135313662 AAGGAAAGAATTGGTGACGTGGG + Intergenic
1185891358 X:3825051-3825073 AGGGAAACTCTTTCTGCCATGGG + Intronic
1185896465 X:3863465-3863487 AGGGAAACTCTTTCTGCCATGGG + Intergenic
1185901583 X:3901891-3901913 AGGGAAACTCTTTCTGCCATGGG + Intergenic
1186365758 X:8891550-8891572 AGGGGGATTATTTGTGACATTGG + Intergenic
1186604514 X:11076569-11076591 AGGGAAATATATTGTGACATGGG - Intergenic
1186972842 X:14867639-14867661 GGGGAAACATTTTATGACATTGG + Intronic
1187262505 X:17699830-17699852 AGGGAAACACTTTCTAACTTTGG + Intronic
1188385972 X:29558618-29558640 AGGGAAATGCTTTTTGACATTGG - Intronic
1188608046 X:32058144-32058166 AGGGAAAAATTTCCTGACATTGG + Intronic
1188732159 X:33663077-33663099 GGGGAAACTATTCATGACATTGG + Intergenic
1189173210 X:38929543-38929565 TGAGAAAATATTTGTGACATTGG - Intergenic
1189305103 X:39980973-39980995 TGGAAAAGAATTTGTGTCATTGG + Intergenic
1190229639 X:48572268-48572290 AGGGGAACATTTTGTGACCTGGG + Intergenic
1190806605 X:53843796-53843818 AGTGAAACAATGTCTAACATTGG - Intergenic
1191216642 X:57938514-57938536 GGGGAAACAATTCATGATATTGG - Intergenic
1191667778 X:63721025-63721047 AGTGAAACAAATTGAGACAAGGG - Intronic
1192758293 X:74068670-74068692 AGTGAACCCATTTGTGACAAAGG - Intergenic
1193177089 X:78406979-78407001 AGGCAAACCATTCATGACATAGG + Intergenic
1194189487 X:90817167-90817189 AGGGAAAATCTTTGTAACATTGG - Intergenic
1194207157 X:91025099-91025121 AAGGACATGATTTGTGACATTGG + Intergenic
1195665909 X:107430245-107430267 AGGGAAAATCTTTGTGACCTTGG + Intergenic
1195963676 X:110410692-110410714 AGGGAAACATTAAGTGAAATGGG + Intronic
1196799446 X:119529526-119529548 AGGGAAATGCTTTATGACATTGG - Intergenic
1197630578 X:128853173-128853195 AGGGAAACACTTCATGACATTGG + Intergenic
1197643102 X:128987963-128987985 GGGGAAACACTTTGGGACACTGG - Intergenic
1197924954 X:131636543-131636565 AGGGACAGAATTTGTTTCATTGG + Intergenic
1198370349 X:135983678-135983700 AGGGAAGCAATCTGTGGCTTCGG + Intergenic
1198430358 X:136559855-136559877 GGGGAAACTTTTTGGGACATTGG - Intergenic
1199418140 X:147610742-147610764 AGGGAAACACTTTATGAAATAGG + Intergenic
1200031552 X:153300546-153300568 GGGGAAACACTTTAGGACATTGG + Intergenic
1200536067 Y:4399057-4399079 AGGGAAAATCTTTGTAACATTGG - Intergenic