ID: 932788623

View in Genome Browser
Species Human (GRCh38)
Location 2:74632390-74632412
Sequence CCTTGGGCCAAGTCCTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932788618_932788623 19 Left 932788618 2:74632348-74632370 CCTAGCTCTGGTACTTTCATTTC 0: 1
1: 0
2: 2
3: 21
4: 271
Right 932788623 2:74632390-74632412 CCTTGGGCCAAGTCCTCCTCAGG 0: 1
1: 0
2: 1
3: 17
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932788623 Original CRISPR CCTTGGGCCAAGTCCTCCTC AGG Intronic
900102095 1:966313-966335 CCTTGGGGCAAGCACCCCTCTGG - Intergenic
900694379 1:4000777-4000799 CCTTGGGCCACGTGGTTCTCTGG + Intergenic
902775797 1:18674156-18674178 CCATGGGCCAGGCCCTCTTCTGG + Intronic
902891096 1:19444264-19444286 CCTGGGGCCATGTACACCTCAGG - Intronic
903420985 1:23217594-23217616 CCGGGGGCCAAGCCTTCCTCCGG - Intergenic
903724037 1:25427869-25427891 CCCTGTGCCAAGATCTCCTCTGG - Intronic
903839092 1:26225533-26225555 TCTTGGGCAAAGTCCTCGCCTGG + Intergenic
904667379 1:32133450-32133472 CCTTGGCTCAAGTGATCCTCTGG - Intronic
905896228 1:41547571-41547593 CCTGGGGCCAAGGCAGCCTCCGG + Intronic
907655086 1:56334016-56334038 ACCTGGGCCAAGGCCCCCTCTGG + Intergenic
909508218 1:76419247-76419269 CCTTCTGTCAAGTCATCCTCTGG - Intronic
909513562 1:76482513-76482535 CACTGGGCCAAGTCCTCCACAGG + Intronic
912315310 1:108662332-108662354 CCTGGGGTCAAGTGATCCTCCGG - Intergenic
912554790 1:110508221-110508243 CCTTTGGGGAAGTCCTGCTCAGG - Intergenic
913322372 1:117598078-117598100 CCCTGGGCCAAGCCCACATCAGG - Intergenic
913500832 1:119471269-119471291 CCTTGCTCCATCTCCTCCTCAGG - Intergenic
916167186 1:161974472-161974494 CCTGGGGCCAGGCCCTGCTCTGG - Intergenic
916922808 1:169486262-169486284 CTGTGGGCCTAGTCCTCCGCTGG + Intergenic
917503149 1:175604165-175604187 CCTTGGCCCATCTCCTCCTCTGG - Intronic
920228619 1:204455677-204455699 CCCCAGCCCAAGTCCTCCTCAGG + Intronic
920356441 1:205376745-205376767 CCTGGGCCCAAGTGATCCTCTGG + Intergenic
922768135 1:228166414-228166436 TGTTGAGCCAAGCCCTCCTCTGG - Intronic
924044070 1:240010290-240010312 CCTTGTGTCATGTCCTCCCCTGG + Intergenic
1064391837 10:14949126-14949148 CCTTGGGCTAAGGAATCCTCTGG - Intronic
1065688437 10:28309013-28309035 CCTTGGGTCAAGTGATCCTCAGG - Intronic
1067275198 10:44827803-44827825 CCTTGGGGCTGCTCCTCCTCAGG - Intergenic
1068938582 10:62658810-62658832 CCTTTGCCCAAGTTTTCCTCGGG - Intronic
1070600928 10:77865781-77865803 CTTTGTGCCAAGGCCTCCTCGGG - Intronic
1073018340 10:100419973-100419995 CCTTGGGCCAGGTACTGCTAGGG + Intergenic
1074824081 10:117202130-117202152 CTGTGGGCCAGGTCCTCCTAGGG - Intronic
1076814855 10:132909649-132909671 CCCTGGGCCCACTCCTCCTTGGG + Intronic
1078142486 11:8702339-8702361 CCTCAGGCCAAGCCCTCCACAGG + Intronic
1079324664 11:19481254-19481276 CCTGGGGCCAGGTGCTCCTCAGG - Intronic
1079340173 11:19605183-19605205 CCTTGCCCCAACTCCTCCCCTGG - Intronic
1083792638 11:64995799-64995821 CCTTGGGCCATGTCCACAGCGGG + Intronic
1083948315 11:65938937-65938959 CCTTGGGCCAAGCCGTTCCCAGG - Intergenic
1085449861 11:76625262-76625284 CCTGAGGACAGGTCCTCCTCAGG + Intergenic
1089582739 11:119491651-119491673 CCCTGTGCCGAGTCCTCCTTCGG - Intergenic
1090349346 11:126097599-126097621 GCTCGGACCACGTCCTCCTCTGG + Intergenic
1090354581 11:126131486-126131508 CCTTGTGTAAAGCCCTCCTCTGG + Intergenic
1090355706 11:126139200-126139222 CCCTGTGATAAGTCCTCCTCAGG + Intergenic
1091034969 11:132224654-132224676 CCATAGGCCAAGTCTTCCTGTGG + Intronic
1091640298 12:2230896-2230918 CTTTGGGCCAAGTCCTTCTTTGG - Intronic
1093194232 12:16111305-16111327 ACTTTGGCCAAGTCCTCTTTAGG - Intergenic
1097329362 12:58316713-58316735 GCTTAGGCCATGTCCTGCTCTGG - Intergenic
1099249355 12:80234144-80234166 CCTGGGCTCAAGTCATCCTCTGG + Intronic
1100204763 12:92336813-92336835 CCTTGGGCCATGTTCCCATCTGG - Intergenic
1102876084 12:116449797-116449819 CCATGGGCCAATTCCTCATACGG + Intergenic
1103144060 12:118578944-118578966 CCATGTGCCACCTCCTCCTCTGG + Intergenic
1104049764 12:125187186-125187208 CCTTGGGCCAAATCCCCCCCAGG + Intronic
1104068444 12:125324956-125324978 CTTTGGGCCAGTTCCTGCTCTGG + Intronic
1105589150 13:21775237-21775259 CCTGGGGTCAAGTGGTCCTCCGG + Intergenic
1112248389 13:97755119-97755141 CCTTGTCCCAAGTGGTCCTCTGG + Intergenic
1113557736 13:111252028-111252050 CCTGGGGCCTTGTCCTCCTGGGG + Intronic
1113882663 13:113636323-113636345 CCTTAGGGCATGTCCTCCTGGGG + Intronic
1115051313 14:29067087-29067109 CCCTGGGCTCAGTCCTCCTTGGG + Intergenic
1117734161 14:58752123-58752145 CCTTTGCCCAAGTTTTCCTCAGG - Intergenic
1118045521 14:61967123-61967145 CCCTGGGACAACTGCTCCTCTGG - Intergenic
1118340632 14:64893993-64894015 CCATGTGCCACCTCCTCCTCTGG + Intergenic
1120163607 14:81170648-81170670 CCTTTTGCCAAGTCCTCTCCTGG - Intergenic
1120785696 14:88533653-88533675 CCTTGGCTCAAGTGATCCTCTGG - Intronic
1121613143 14:95294711-95294733 CCTGGGGGCAGGTCCTCCACAGG + Intronic
1122569249 14:102683632-102683654 CTTTGGGCCAAGCTCTCCTCTGG + Intronic
1123712154 15:22996415-22996437 CCTGGGCCCAAGTAGTCCTCTGG - Intronic
1125019296 15:34969309-34969331 CCTTGGGCCATGAACTCCCCAGG + Intronic
1126108724 15:45163347-45163369 CCCTGGGCCAACTCCATCTCTGG + Intronic
1129372554 15:75106603-75106625 CCTTCAGCTAAGTCCTCCTCGGG + Intronic
1129912064 15:79236081-79236103 ACTTGGGTCAAGTCCAGCTCAGG + Intergenic
1132550409 16:551706-551728 CCTAGGGCCGAGTCCTTCTCTGG + Intronic
1134069000 16:11249348-11249370 CCTTGGGACATGCCCTCCCCGGG + Intergenic
1136367301 16:29814685-29814707 CCTTGGGCCCATCCCTCCCCTGG + Exonic
1136718823 16:32303792-32303814 GTTTCGGCCAAGTCCTGCTCTGG - Intergenic
1137644895 16:50065637-50065659 CCTGGGGTCAAGTGATCCTCCGG + Intergenic
1138155470 16:54698911-54698933 CCTTGGGCCCAGACCAACTCAGG + Intergenic
1140037925 16:71385157-71385179 CCCAGGGCCAAGTCTTTCTCTGG + Intronic
1140561961 16:75993972-75993994 CTTTGGGGCAAGCCATCCTCAGG - Intergenic
1141985241 16:87575571-87575593 CCTTGGGCCAAATCCCACTGCGG + Intergenic
1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG + Intronic
1203007608 16_KI270728v1_random:213979-214001 GTTTCGGCCAAGTCCTGCTCTGG + Intergenic
1145944316 17:28761499-28761521 CTTTGGGCCAAGGCCACCTGAGG - Intronic
1146108848 17:30068745-30068767 CCTTGGGCCAGGGACTCCTGCGG - Intronic
1146887032 17:36478531-36478553 CCTGGGGTCAAGTTTTCCTCAGG - Intergenic
1150105422 17:62459282-62459304 CTATGGGCCAGGTCCTCCTGGGG + Intronic
1151652195 17:75476966-75476988 GCTTGGGTCCAGTCCTGCTCTGG - Intronic
1152006916 17:77688129-77688151 CCTTGTTCCACGTCCCCCTCCGG + Intergenic
1152100776 17:78300734-78300756 CCTAAGGCCACCTCCTCCTCAGG + Intergenic
1158426715 18:57346891-57346913 ACTGGGGCCAAATCCTCTTCTGG + Intergenic
1161314783 19:3612727-3612749 CCCTGGGCCAGGACCCCCTCGGG - Intronic
1161511263 19:4673207-4673229 CCATGGCTCAAGTCATCCTCTGG - Intergenic
1161668201 19:5589758-5589780 CACTGGGCCAGGTCCTCCACAGG - Intronic
1161949314 19:7458991-7459013 CCTTGGGCCGAGCACCCCTCAGG + Intronic
1165752771 19:38270907-38270929 CGGTGGGCCAAGGCCTCCTGGGG - Intronic
1166117842 19:40666903-40666925 CCTTGGGCCAAGGTCTCATGGGG - Exonic
1168653519 19:58110105-58110127 CCTTGCCTCAAGTGCTCCTCCGG + Intronic
926269104 2:11351673-11351695 CCTTGGGCCATGTCTCCTTCAGG + Intergenic
927250810 2:20993484-20993506 CCCTGAGCCAAGTCCTACTGAGG - Intergenic
927855937 2:26528029-26528051 ACTTGGGCCCAGTGCTCCCCAGG + Intronic
928195914 2:29216321-29216343 GCTAGGGCCAGGGCCTCCTCTGG - Intronic
928338440 2:30419628-30419650 CCTTGGTTCAAGTGATCCTCTGG + Intergenic
930075012 2:47399444-47399466 CCTGGGCTCAAGTGCTCCTCTGG + Intergenic
931947853 2:67331397-67331419 CCTGGGCCCAAGTGATCCTCTGG - Intergenic
932788623 2:74632390-74632412 CCTTGGGCCAAGTCCTCCTCAGG + Intronic
936049046 2:109209273-109209295 CCTTGTGCCAGGTCCTGCGCGGG + Intronic
937276190 2:120685612-120685634 CCATGGGCCAGGCCCTACTCTGG - Intergenic
942408179 2:175677799-175677821 CCTTGGCAGAAGTCCTACTCTGG + Intergenic
942807907 2:179956198-179956220 TCTTGCTCTAAGTCCTCCTCTGG - Intronic
944858603 2:203792425-203792447 CCATGGTCCAAGCCTTCCTCAGG - Intergenic
946845650 2:223856676-223856698 CCATGGGCCAAGTCCTGCTGAGG + Intronic
947767460 2:232646858-232646880 CCTTGGGCCAAGCCCTGGGCTGG - Intronic
948231519 2:236352335-236352357 CCATGCGCCACGTCCTCCCCAGG - Intronic
948589652 2:239040822-239040844 ACTAAGGCCAAGGCCTCCTCTGG + Intergenic
948902795 2:240964749-240964771 CTTTGGGCCACGCCCTGCTCAGG + Intronic
1168840967 20:909945-909967 CCTTGGGCCAAGGGTTCCTGGGG + Intronic
1169376310 20:5069230-5069252 CCTTGAGCTGAGTCCTCCTTCGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1173163499 20:40669982-40670004 CCCTGGGCCAGCTCCTCCTAAGG - Intergenic
1175004294 20:55665949-55665971 CCTTAGGCCAAGCCCACCCCAGG + Intergenic
1175492019 20:59385656-59385678 CCTCTGGGCAAGTCCTCCTAGGG + Intergenic
1175773010 20:61635568-61635590 CCTTGTGCCCTGTCCTTCTCAGG - Intronic
1176064333 20:63186988-63187010 CCTGGGGCCAAGACACCCTCAGG + Intergenic
1176295222 21:5068449-5068471 CCTGGGCTCAAGTCATCCTCTGG + Intergenic
1176374638 21:6080929-6080951 CCTGCGTCCAAGTCCTCCTGGGG - Intergenic
1178478180 21:32956057-32956079 CCTTGGGCCCTTTCCCCCTCTGG - Intergenic
1179748837 21:43457316-43457338 CCTGCGTCCAAGTCCTCCTGGGG + Intergenic
1179861827 21:44193679-44193701 CCTGGGCTCAAGTCATCCTCTGG - Intergenic
1180877420 22:19181105-19181127 TGGGGGGCCAAGTCCTCCTCTGG + Intronic
1181000958 22:19987470-19987492 ACTTTGGCCAAGTCCTTCCCAGG + Intronic
1184550005 22:45199458-45199480 CCTTGGGCCAGCTCGCCCTCAGG - Intronic
949573427 3:5315280-5315302 CCCTGGCCCAACTCCTCTTCTGG + Intergenic
950219438 3:11183348-11183370 CCTAGGGTCAAGACCACCTCTGG - Intronic
950964687 3:17138080-17138102 CCTGGGGCCACGTCCAGCTCAGG + Intergenic
953802187 3:46032587-46032609 CCTTTGCCCAAGTTTTCCTCAGG - Intergenic
954139717 3:48598632-48598654 CCTTGTGCCAAGTCACCCCCTGG - Intergenic
954535855 3:51358762-51358784 CCTTGGGCCAAACCCTACTGTGG - Intronic
959582240 3:107993504-107993526 CCTTGGGGAAAGTTCTCTTCTGG + Intergenic
962028185 3:131571216-131571238 CCTTGGGCCTTCTTCTCCTCTGG + Intronic
963060480 3:141221066-141221088 CCTTGGGCAAAGTCAGCCTGTGG - Intergenic
965493793 3:169372881-169372903 CCTGGTCTCAAGTCCTCCTCAGG - Intronic
966388867 3:179430429-179430451 GTTTGGGCCAATTCCTCCACTGG + Intronic
967742585 3:193019656-193019678 CTTTGGGCCAAGTGTTCCTTAGG - Intergenic
967894623 3:194385962-194385984 CCCTGGGCCAGGTCCTTGTCTGG + Intergenic
969135399 4:5025059-5025081 ACTTGGGCCAGGTCCTCCCCAGG + Intergenic
969437669 4:7198115-7198137 CCTTGGTCCAAGCCTCCCTCTGG - Intronic
969476906 4:7427064-7427086 CCTTGGGCCACGGCCTCCCAGGG + Intronic
969607517 4:8209999-8210021 CCAGGGGCCATGTCCCCCTCTGG - Intronic
971460963 4:26896014-26896036 GGTTGGGCCATGTCCTCATCTGG + Intronic
971601053 4:28592609-28592631 CCTTGGGCTATCTCCTCCCCTGG + Intergenic
979157170 4:117410663-117410685 CCTTAGGCAAAGTCTTTCTCAGG - Intergenic
981934082 4:150220051-150220073 CCCTGGTCCAAGTCCTTCTCCGG - Intronic
985517596 5:354871-354893 CCATGGGCCACGTCCTTCCCTGG - Intronic
991435892 5:66596764-66596786 TCCTCGGCCGAGTCCTCCTCGGG + Exonic
994740266 5:103609664-103609686 CCTTTGGCTCAGTCCACCTCAGG - Intergenic
997720294 5:136073279-136073301 CTTTGTACCAAGTCCTTCTCAGG - Intergenic
999133042 5:149299261-149299283 CCTTGGGCCAAGGCCATCTGAGG + Intronic
999198873 5:149802118-149802140 CCTTGGGCCAAGTCCTGAGAAGG - Intronic
1001283289 5:170403636-170403658 CCCAAGGCCAAGTGCTCCTCTGG + Intronic
1001777760 5:174341763-174341785 CCTTGGGCCAGGAGGTCCTCTGG + Intergenic
1004179157 6:13365815-13365837 CCTGGGCTCAAGGCCTCCTCCGG - Intronic
1004604365 6:17179866-17179888 CCTTGGGCAGAGTCAGCCTCTGG + Intergenic
1004903206 6:20212459-20212481 CCTTGGGCCCGGCCCTCCTACGG - Intergenic
1006429834 6:33988729-33988751 CCTTGGGCCCTGCCCTTCTCAGG - Intergenic
1007622634 6:43224245-43224267 CCTAGGCCCCAGGCCTCCTCAGG + Exonic
1010933124 6:81827798-81827820 CCCTGGGCCAAGGCCTTTTCAGG + Intergenic
1016199721 6:141394008-141394030 CCTGGGCCCAGGTCCACCTCAGG - Intergenic
1017442230 6:154474958-154474980 CCTTGGGCCAGCTCTTCCGCAGG - Intronic
1018743682 6:166748546-166748568 CCTTGGGCCCCCACCTCCTCAGG + Intronic
1018743727 6:166748642-166748664 CCTTGGGCCCCCACCTCCTCAGG + Intronic
1018807853 6:167275242-167275264 CATTCTGCCACGTCCTCCTCTGG + Intronic
1018884846 6:167926522-167926544 TCCTGGGCCAAGTGATCCTCCGG + Intronic
1019331270 7:461990-462012 CCGTGTGCCATGTCCTCCCCTGG - Intergenic
1024167669 7:46750755-46750777 CCTTGGACACATTCCTCCTCAGG - Intronic
1024318780 7:48045130-48045152 CCTGGGACCTTGTCCTCCTCTGG + Intronic
1029294947 7:99533095-99533117 CCTTGGTCCAACTCCTTCTATGG - Exonic
1030716325 7:112812002-112812024 ACTGGGGCAAAGTTCTCCTCAGG - Intergenic
1032168366 7:129563599-129563621 TCTTGGGCCAAGTCCTTCGCAGG + Intergenic
1032816156 7:135476582-135476604 TCCTGGGCCAAGTGATCCTCTGG - Intronic
1035169361 7:157009254-157009276 ACTTGGGCCAGGTCCCCCACTGG - Intronic
1042664906 8:71194110-71194132 CCTTGGGCCAGCTCCTCCCCAGG + Intergenic
1043637160 8:82400126-82400148 CCTTGGGACAAGGCATCCACAGG + Intergenic
1045555219 8:103208885-103208907 CCTATGGCCAGGTCCTCCTGGGG - Intronic
1047637457 8:126779983-126780005 CCTGGGCTCAAGTCATCCTCCGG - Intergenic
1048665706 8:136658311-136658333 CCTTGGGCCAGGTCCTCTTCAGG + Intergenic
1049213401 8:141396941-141396963 CCTTGAGCCAGGTACTCCTGTGG + Intronic
1049382360 8:142323659-142323681 CCTTGGGCCAAGTGCCCTGCTGG - Intronic
1049695771 8:143983691-143983713 CCTGGGGTCACCTCCTCCTCTGG + Exonic
1050691166 9:8228069-8228091 CTTTGTTCCAAGTCCTACTCCGG - Intergenic
1053511461 9:38691273-38691295 CCTTGTGCCAGGTTCTGCTCTGG + Intergenic
1057404687 9:94758239-94758261 CCTAGAGTCAAGTCCTCTTCAGG + Intronic
1057769482 9:97954858-97954880 CCTTCCTCCAAGTCCTCCTCTGG + Intergenic
1058444554 9:105043312-105043334 CCTGGGCTCAAGTCATCCTCTGG - Intergenic
1060958054 9:127658464-127658486 CCTTAGCCAGAGTCCTCCTCTGG - Intronic
1062141082 9:134959510-134959532 CCTGGAGCCAGGTCTTCCTCAGG - Intergenic
1062697168 9:137881321-137881343 CCTTGGGCCAGCTCCACCACAGG + Intronic
1185709980 X:2296286-2296308 GCTTGGGCCACGTCCTCTGCTGG + Intronic
1186500384 X:10045998-10046020 CGCTGGGCCAAGTCCACCTGAGG - Intronic
1195618397 X:106930553-106930575 CCCTTAGCCAAGTCCTCCTCAGG + Exonic
1198110120 X:133495649-133495671 CCTTCGTCCCAGGCCTCCTCTGG + Intergenic
1199371775 X:147057903-147057925 CCTTGGGCAAACTCATCCCCTGG - Intergenic
1201065116 Y:10089504-10089526 CCATGGGCCAGGTCTTCCTTGGG - Intergenic
1201763027 Y:17559168-17559190 CCATGGGCCATGTCCTTGTCCGG + Intergenic
1201838525 Y:18346821-18346843 CCATGGGCCATGTCCTTGTCCGG - Intergenic