ID: 932791636

View in Genome Browser
Species Human (GRCh38)
Location 2:74658593-74658615
Sequence CCCAAGCCTGCCTGTGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932791636_932791638 3 Left 932791636 2:74658593-74658615 CCTCAAACACAGGCAGGCTTGGG 0: 1
1: 0
2: 1
3: 23
4: 259
Right 932791638 2:74658619-74658641 TGTGTATCCTAATCACATCTAGG 0: 1
1: 0
2: 1
3: 12
4: 174
932791636_932791641 21 Left 932791636 2:74658593-74658615 CCTCAAACACAGGCAGGCTTGGG 0: 1
1: 0
2: 1
3: 23
4: 259
Right 932791641 2:74658637-74658659 CTAGGCTAGTCATGATCTCTGGG 0: 1
1: 0
2: 17
3: 558
4: 6164
932791636_932791640 20 Left 932791636 2:74658593-74658615 CCTCAAACACAGGCAGGCTTGGG 0: 1
1: 0
2: 1
3: 23
4: 259
Right 932791640 2:74658636-74658658 TCTAGGCTAGTCATGATCTCTGG 0: 1
1: 0
2: 1
3: 8
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932791636 Original CRISPR CCCAAGCCTGCCTGTGTTTG AGG (reversed) Intronic
900157897 1:1210910-1210932 CCCAAGGCTGCCTGGGGTGGAGG - Intergenic
900329319 1:2126267-2126289 CCAAAGTCTGCCAGTGTTGGTGG + Intronic
900778550 1:4602106-4602128 CCCAGGGCTGAGTGTGTTTGGGG + Intergenic
900829586 1:4956434-4956456 CCCAAGCCTGCCACCATTTGGGG - Intergenic
902155971 1:14486718-14486740 CCCAAGCCTGAAGGTGTTAGTGG - Intergenic
902445233 1:16458969-16458991 CCTCAGCTGGCCTGTGTTTGGGG + Exonic
902744098 1:18461682-18461704 CCAGAGCCTGCCTTTGTTTGTGG + Intergenic
904449429 1:30601461-30601483 CCCCAGCTTGCCTGTGTTACAGG - Intergenic
904921784 1:34013727-34013749 CCCAAGGCTGCCTTTGCCTGTGG - Intronic
905795787 1:40815849-40815871 CCCAGTCCTGCTTGTGTGTGTGG - Intronic
907803362 1:57793828-57793850 CCCAAGGCTGCCTCTTTGTGAGG - Intronic
908016473 1:59843164-59843186 GCTATGCCTGCCTTTGTTTGGGG - Intronic
908514622 1:64879926-64879948 CCCCAACCTGCCTATGTTTCAGG - Intronic
912247196 1:107971839-107971861 CCCAACCCTGACTATCTTTGAGG + Intergenic
912940214 1:114038186-114038208 CCCATGCCTGCCTGTCCTGGGGG - Intergenic
913045096 1:115067653-115067675 TCCAAGCCTGGCTCTGATTGTGG - Intronic
915267703 1:154730903-154730925 CCCACCCCTGCCTCTCTTTGGGG - Intronic
918452269 1:184670882-184670904 CCCAACCCTTCCTGCTTTTGAGG + Intergenic
920160864 1:203996766-203996788 TCTAAGCCTGCCTGTGGCTGTGG - Intergenic
920176881 1:204107633-204107655 CTCAAGCAGGCCTGTGCTTGGGG + Intronic
922501021 1:226096980-226097002 CCCCAGCCTACCTCTGTGTGGGG + Intergenic
923732172 1:236562537-236562559 CCTATGCCTGCATGTGTTTCTGG + Intronic
1062984233 10:1752526-1752548 CCCCAGCATTCCTGTGTGTGTGG - Intergenic
1067523194 10:47023088-47023110 TCCAAGCCTGCCTCTGAGTGTGG + Intergenic
1067957461 10:50808104-50808126 CACATGCATGCATGTGTTTGTGG + Intronic
1069248314 10:66236823-66236845 ACCATGCCTGGCTGTATTTGAGG - Intronic
1070093885 10:73317311-73317333 CCCAGCCCTGCCTTTGTTTTTGG + Intronic
1070401369 10:76056228-76056250 CCCAAGTCTGGCTGAGTCTGGGG + Intronic
1071839781 10:89457885-89457907 CCCAAGTCTGATTGTGATTGTGG + Intronic
1073009083 10:100346509-100346531 CACCAGCCAGCCTGTGTGTGCGG + Intergenic
1073214919 10:101830837-101830859 CCCAGGCCGGCGTGTGTGTGTGG - Intronic
1073476648 10:103757968-103757990 CGCAAGCCTGTCTGTGCTCGTGG - Intronic
1073909304 10:108322970-108322992 GCCAAGTCTTCCTATGTTTGGGG - Intergenic
1074311057 10:112323753-112323775 CCCCAGCATTCCTGGGTTTGTGG - Intergenic
1075186190 10:120260522-120260544 CCCAAGCCTCTTTGTGTTTCTGG + Intergenic
1076348807 10:129800705-129800727 CCAAGGCCAGCCTGTGTTTGTGG + Intergenic
1076746097 10:132515269-132515291 CCCAAGGCCGTCTGTGTTTCTGG + Intergenic
1076909068 10:133378507-133378529 CCCAGGCACGCCTGTGTTTCTGG - Intergenic
1077279343 11:1735043-1735065 CTCCACCCTGCCTGTGTCTGGGG - Exonic
1078025380 11:7690046-7690068 TCCAACCCTGGCTGTCTTTGTGG - Intronic
1080846326 11:36030181-36030203 CACAAGGCTGTCTGAGTTTGGGG - Intronic
1081787098 11:45755561-45755583 TCCAAGGCTGTCAGTGTTTGGGG - Intergenic
1084536211 11:69758729-69758751 ACAAAGCTTGCCTGTCTTTGTGG - Intergenic
1084543673 11:69802874-69802896 CTCAAGTCTGCCTTTGGTTGAGG - Intergenic
1089331561 11:117692435-117692457 CCCTATCCTGAGTGTGTTTGGGG - Intronic
1090928669 11:131275941-131275963 ACCAAGCATGCCTGTGTTCCAGG - Intergenic
1091349355 11:134880690-134880712 CAGAAGCTAGCCTGTGTTTGAGG + Intergenic
1091721875 12:2819929-2819951 CCCGCCCCTGCCTGTGTTTGCGG - Intronic
1091796250 12:3298962-3298984 CCCAAGCCTGCGCGTGCTTTGGG - Intergenic
1093493101 12:19726501-19726523 CCCAGGCCTCCCTGTGCTTTTGG - Intergenic
1095271560 12:40224967-40224989 CCCACGCCCGCCTGTTTATGAGG - Intronic
1096795920 12:54077545-54077567 CCCACGACTGCCAGTTTTTGTGG - Intergenic
1098702446 12:73645909-73645931 CCAAAGCTTGCCTGAGTCTGGGG + Intergenic
1100965643 12:100010424-100010446 CCCAGGCCTTCCTTAGTTTGTGG - Intergenic
1104704589 12:130933774-130933796 CCCAAGCCTGCCTCCGTGTCGGG - Intergenic
1105292612 13:19062296-19062318 GCCAAGCCAGCCTGAGTTAGGGG - Intergenic
1105816329 13:24039722-24039744 CCCAATCCTGCATGTGACTGGGG + Intronic
1105816378 13:24040122-24040144 CTCAAGCCTGTCTGTGTTTGGGG - Intronic
1107965901 13:45598078-45598100 TCCATGCCTGCCTGTCTTTCTGG + Intronic
1109348485 13:61145648-61145670 CCCAAGTCTGGCTGAGTCTGAGG - Intergenic
1110830827 13:80029032-80029054 CCCAAGCCAACCTGTATTTATGG + Intergenic
1113065535 13:106370481-106370503 CCCCAGTCTGCCTATTTTTGAGG + Intergenic
1113528839 13:111004892-111004914 TCCAGGCCTGCCTGTGGTTTTGG + Intergenic
1116355607 14:43924867-43924889 CCCCAGCTTGCCTGTGTTACAGG - Intergenic
1117399663 14:55347236-55347258 CCCATGCCTGCCTTTGTGTGTGG + Intronic
1118695192 14:68377676-68377698 CACAAGCCCTCCTCTGTTTGTGG - Intronic
1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG + Intronic
1119257167 14:73208617-73208639 CCCAAGTCTGACTGAGTCTGGGG + Intronic
1119331052 14:73793902-73793924 TCCCAGCCAGACTGTGTTTGGGG - Intergenic
1119383797 14:74244794-74244816 CACTACCCTTCCTGTGTTTGGGG - Intronic
1122880963 14:104690228-104690250 CCTAAGCCTGCCAGCGGTTGCGG - Intronic
1122941087 14:104981721-104981743 CCGCAGCCTGCCTGTTTGTGGGG - Intergenic
1124041901 15:26113393-26113415 CCCAGGCCAGCCTGTGATTGCGG + Intergenic
1124258359 15:28164247-28164269 CCCCAGCCTGTTTATGTTTGTGG - Intronic
1124360696 15:29034814-29034836 CCCAAGAGTTTCTGTGTTTGTGG + Intronic
1126990835 15:54374107-54374129 CCCAAGTCTGTCTGAGTCTGGGG + Intronic
1128311502 15:66633972-66633994 CCTGAGCCTGCCTGTCTGTGAGG - Intronic
1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG + Intergenic
1129377848 15:75145388-75145410 CCCAGGCCTCCCTGTGCTTTTGG - Intergenic
1130150724 15:81309523-81309545 CACAAACCTGCCTGGGTTTAAGG + Exonic
1133253406 16:4500354-4500376 ACTTAGCCTCCCTGTGTTTGTGG + Intronic
1134235551 16:12462708-12462730 GCCAAGTCTTCCTGGGTTTGGGG - Intronic
1135345470 16:21685218-21685240 TCCACGGCTGCCTGTATTTGGGG - Exonic
1138125651 16:54436351-54436373 CCCACGCCTTCCTGTGATGGAGG - Intergenic
1139082330 16:63538241-63538263 CACAAAACTGCCTATGTTTGGGG + Intergenic
1139090946 16:63646524-63646546 ACCAGGACTGCCAGTGTTTGAGG - Intergenic
1139496718 16:67325731-67325753 CCTAAGCTTGCCTGTGACTGAGG - Intronic
1139606935 16:68025633-68025655 CCTAAGCCTGTCTGTGTCCGTGG + Intronic
1140662050 16:77197577-77197599 ACCAAGCCTGGCTATGTTTGAGG + Intronic
1141612125 16:85187730-85187752 CCCAAGCCTGTCCCTGTGTGTGG - Intergenic
1142216488 16:88832443-88832465 CACAAGCCTCCCGGTGTTTGGGG + Intronic
1142594369 17:1022384-1022406 CCGAAGCCGGCCTGTCATTGGGG + Intronic
1144721816 17:17476397-17476419 CTCAAGGCTTCCTGTGTTTGTGG + Intergenic
1144734524 17:17547616-17547638 CCCAGCCCTGCCTGTGTGTCTGG + Intronic
1147357170 17:39907173-39907195 CCTATGACTGCCTGTTTTTGAGG - Intronic
1148771220 17:50068024-50068046 ACTAAGGCTGCCTGTGTTTGGGG + Intronic
1149350753 17:55784335-55784357 CGCAATCCTGACTGTGTATGTGG - Intronic
1149480742 17:57001189-57001211 CCTGAGCCTACCTGGGTTTGGGG + Intronic
1149681291 17:58509043-58509065 CCCAAGAACTCCTGTGTTTGAGG + Intronic
1149880574 17:60286445-60286467 CCCAAGCATTCCTTGGTTTGTGG - Intronic
1151365906 17:73616357-73616379 CCTGAGCCTGCATGTGTGTGTGG - Intronic
1151566221 17:74900018-74900040 TCCAAGCCAGCCTGTGGCTGGGG - Intergenic
1151850211 17:76685528-76685550 ACCACGCCTGCCTGGGCTTGGGG + Intronic
1151894738 17:76972332-76972354 CCCAAGGCTGCCTCTCTTGGGGG + Intergenic
1152633592 17:81421403-81421425 CCCCCGCCTCCCGGTGTTTGGGG - Intronic
1153051034 18:903577-903599 CCCATCCCTGCCTGGATTTGAGG - Intergenic
1153428776 18:4992890-4992912 CCCAAGTCTGGCTGAGTCTGGGG + Intergenic
1153591247 18:6675868-6675890 CCCAAGCCTCCTGGTGTGTGGGG + Intergenic
1153647130 18:7205293-7205315 CCCAAGGCTGTGTGTGTCTGGGG + Intergenic
1157338675 18:46759036-46759058 AGCCAGCCTGCCTGTGTGTGTGG - Intronic
1157910080 18:51608895-51608917 CCCAACCCTGCCTGTGTACAAGG - Intergenic
1160298237 18:77656787-77656809 CCCAAGCCATCCTGAATTTGGGG + Intergenic
1160934167 19:1585350-1585372 CCAGGGCCTGCCTGGGTTTGGGG - Intronic
1161327354 19:3670198-3670220 CCCACGCCTGCCTGAGGGTGCGG + Intronic
1162530288 19:11232048-11232070 CCCTCTCCTGCCTTTGTTTGGGG - Intronic
1163049583 19:14672158-14672180 CCCCAGACTGCCTGAGTTTTAGG - Intronic
1163989241 19:20983009-20983031 CCCAAGCCTTCCTTGGTTTCAGG - Intergenic
1164309794 19:24035460-24035482 GCCAAGTCAGCCTGTTTTTGAGG + Intronic
1164591733 19:29511205-29511227 CCCAAGCCTGCCTGGCGTGGAGG + Intergenic
1164681497 19:30136802-30136824 CCCAAGCATTCCTGTGCCTGTGG + Intergenic
1166365285 19:42275149-42275171 GGCCAGCCTGCCTGGGTTTGAGG - Intronic
926417206 2:12661460-12661482 CCCCAGCATTCCTGGGTTTGTGG - Intergenic
926515530 2:13840507-13840529 CTCAAGACTGCGGGTGTTTGTGG - Intergenic
927500538 2:23579952-23579974 CCCAAGGCTGCCTGTCTTTAAGG - Intronic
928317346 2:30256382-30256404 TCCCAGCCTGCCTGTGACTGGGG + Intronic
928466034 2:31523264-31523286 CCCATGCCTGTTTGTGTGTGAGG - Exonic
930255734 2:49088169-49088191 CACAAGTCTGCGTGTGTATGTGG + Intronic
930344071 2:50156354-50156376 CACTAGCGTGCCTGTGTTTTAGG + Intronic
931011624 2:57922098-57922120 CCTAAGGCTACTTGTGTTTGAGG + Intronic
932791636 2:74658593-74658615 CCCAAGCCTGCCTGTGTTTGAGG - Intronic
935125482 2:100218831-100218853 CCCAAGAGTACCTGTGTTGGTGG - Intergenic
935870752 2:107446507-107446529 ACCAAGCCTGACTGAGTTTCTGG - Intergenic
936531602 2:113279940-113279962 CCCAGGCCTGCCAGTGTTCCAGG - Intergenic
938579810 2:132635741-132635763 CCCAAATCTGACTGTATTTGGGG + Intronic
940625960 2:156175589-156175611 CCCAAGCTTGGTTCTGTTTGAGG - Intergenic
941583765 2:167331685-167331707 CCCCAGCCTGGCTCTGTTTCTGG - Intergenic
942431560 2:175916962-175916984 CCCCAGCCTGCCTGAGTATGAGG + Intergenic
943750944 2:191508863-191508885 CCTAAGGCTTCATGTGTTTGGGG + Intergenic
945381157 2:209142438-209142460 CCCAATGCTGTGTGTGTTTGAGG - Intergenic
946284191 2:218690444-218690466 CCCCAGCCTGCAGGTGTTTCAGG + Exonic
946572442 2:221039779-221039801 CCAAAGCCTGACTGTGTTTCAGG - Intergenic
946793409 2:223324206-223324228 CCCAACCCTGCCTGTGCTGCAGG - Intergenic
1169880523 20:10341794-10341816 CCCAAGTCTGGCTGTGTCTGGGG - Intergenic
1173231803 20:41204277-41204299 CCCTAGCCAGCCTGTGGGTGAGG - Exonic
1173386424 20:42592551-42592573 CCCAAGCTTCACTGTGTTTAGGG - Intronic
1174743055 20:53034664-53034686 CCCAAGCATGCCAGGATTTGAGG + Intronic
1175237433 20:57524748-57524770 CCAAAGCCTGCCTGGCTCTGAGG - Intronic
1175278531 20:57787896-57787918 CTCAAGCCTGCCGGGGTCTGAGG + Intergenic
1176004114 20:62850495-62850517 CACAAGGCTTCTTGTGTTTGTGG - Intronic
1176121585 20:63456550-63456572 CCCAACCCTGGCTCTGTCTGAGG - Intronic
1176233917 20:64045433-64045455 CCCCAGGCTGTCTGTGTCTGTGG + Intronic
1176412344 21:6455839-6455861 CCCCAGGCTGCCTGTTTCTGAGG - Intergenic
1178707691 21:34888977-34888999 CACAAGCCTGCGTGTGGCTGCGG - Intronic
1179481265 21:41680173-41680195 CGCAAGCATGCCTGTGTATGTGG + Intergenic
1179573450 21:42291917-42291939 CCTAAGCGTGGCTGTGCTTGGGG - Intronic
1179687838 21:43064161-43064183 CCCCAGGCTGCCTGTTTCTGAGG - Intronic
1179991445 21:44950149-44950171 CCCCACCCTGCCTGTGTCTCTGG + Intronic
1180949007 22:19712559-19712581 CCCATGCAAGCCTGTGCTTGTGG - Intergenic
1180956522 22:19743737-19743759 CCCTCGCCTGCCTTTGCTTGTGG - Intergenic
1182062247 22:27406675-27406697 CCCAAGCTTGCCTGAGGCTGAGG - Intergenic
1183102367 22:35591868-35591890 GCCCAGCCTGCCTGTGTGTGTGG + Intergenic
1184365714 22:44049920-44049942 CCCATGCCTACTTGAGTTTGGGG + Intronic
1185095451 22:48803814-48803836 GCCAAGCCTGACTGTGTGGGAGG + Intronic
1185377000 22:50487279-50487301 TCCAAGCCTGCCTCTGCTCGAGG - Intronic
949242349 3:1888006-1888028 GCCATGGGTGCCTGTGTTTGTGG - Intergenic
949578208 3:5359670-5359692 CCCAAGCATGACTTTTTTTGTGG + Intergenic
950428736 3:12938817-12938839 CCCAAACCTGTGTGTGTTGGGGG + Intronic
950520063 3:13492831-13492853 ACCAAGCCTGGCTGGGTGTGGGG + Intronic
950787627 3:15449579-15449601 CCCAGGCCTGCATGTGTTTCAGG + Intronic
952315781 3:32231078-32231100 CCCATGAATGACTGTGTTTGAGG - Intergenic
952723789 3:36560705-36560727 CCCAAGGCCCACTGTGTTTGTGG - Intergenic
952793352 3:37217722-37217744 CCCAAGTCTGCCTGAGTCTGGGG - Intergenic
953567257 3:44043415-44043437 AAGAAGCCTGCCAGTGTTTGAGG + Intergenic
953922230 3:46960164-46960186 CCCCAGCCTGACCGTGCTTGAGG + Intronic
956753475 3:72363397-72363419 ACTCACCCTGCCTGTGTTTGTGG + Intergenic
956966345 3:74465722-74465744 CCCCACCCTGCCAGTGTGTGAGG + Intronic
958558916 3:95717983-95718005 CCAGTGCCTGCCTGTATTTGGGG - Intergenic
960050246 3:113232600-113232622 CACATGCCTGCCTGTCTTAGAGG + Intronic
961680845 3:128598957-128598979 CACAGGGCTGCCTGGGTTTGAGG + Intergenic
962136579 3:132741298-132741320 CCCAGGCCTGTCTGTGGGTGGGG - Intergenic
963265629 3:143237584-143237606 CCACAGCCTGCCTGTGTTGTGGG - Intergenic
965367794 3:167820940-167820962 CTCAAGTCTGACTGAGTTTGGGG - Intronic
966447450 3:180018757-180018779 CCCAGGCCTGCCTGTCTTACTGG + Intronic
967997801 3:195179973-195179995 CTGGAGCCTGCCTGTGTTGGGGG - Intronic
968027642 3:195455952-195455974 CACAATCCTACCTGTGTGTGAGG + Intergenic
968295786 3:197575547-197575569 CCCCAGCTTGCCTGTGTTATAGG - Intergenic
968838324 4:2981598-2981620 CCCAAGTCTGGCTGAGTCTGGGG + Intronic
969361018 4:6664019-6664041 CCCAAGCCTCCCTGAGCCTGCGG + Intergenic
971245867 4:24927070-24927092 CCCAAGCTTGTCTGGATTTGAGG + Intronic
972281924 4:37610436-37610458 CCAAAGTATGCCTGTGTTAGGGG + Intronic
972669326 4:41198820-41198842 CCCAAGCATCCCTTGGTTTGTGG + Intronic
972676510 4:41265085-41265107 CCCAACCCAGCCTGTGCTGGTGG - Intronic
973259448 4:48147041-48147063 CCAAAGCCTGGCTCTGTTTCTGG + Intronic
973981385 4:56310959-56310981 TCCCAGCATGCCTGTGTTTGGGG + Intronic
975321343 4:73012230-73012252 CTCAAGCCTGGCTGAGTCTGGGG - Intergenic
976097803 4:81527944-81527966 CCCAAGTCTGGCTGAGTCTGGGG + Intronic
978959305 4:114656741-114656763 CCCAAGGCAGGCTGTATTTGGGG + Intronic
979724208 4:123941548-123941570 CCTTAGCCAGCCTCTGTTTGAGG - Intergenic
981950678 4:150403180-150403202 CCCTCCCCTGCCTGTGTTTCTGG - Intronic
983370193 4:166848739-166848761 AACAAGCCGGCCAGTGTTTGAGG + Intronic
984169420 4:176343176-176343198 CCCAAGCCTGGCTGAGTCTGGGG + Intergenic
984369357 4:178842407-178842429 GGCAAGCCAGTCTGTGTTTGGGG - Intergenic
985581204 5:696082-696104 CCCACCCCTGCCTGGGTTTGGGG + Intergenic
985595829 5:787414-787436 CCCACCCCTGCCTGGGTTTGGGG + Intergenic
985649051 5:1098893-1098915 CCGAGCCCTGCCTGTGTTTTGGG + Intronic
985996112 5:3597913-3597935 GGGAACCCTGCCTGTGTTTGCGG + Intronic
987951936 5:24687259-24687281 CCCAAGTCTGGCTGAGTCTGGGG + Intergenic
989520679 5:42396673-42396695 CCCAAGTCTGGCTGAGTCTGGGG - Intergenic
990889399 5:60632341-60632363 CCCCAGCGTGCCTGTGGTGGTGG - Intronic
991978177 5:72203603-72203625 CCCAGGCCTCCCTGTGTATTTGG + Exonic
996450034 5:123610574-123610596 CACAAGCCTGTATGTGTTTTAGG + Intronic
997192007 5:131946035-131946057 CACAAGACTGCCTGTGCTGGTGG - Intronic
997197130 5:131987708-131987730 CCTCAGCCTGTCTGTGTCTGAGG - Intronic
997426753 5:133808460-133808482 CTCAAGCCTGGGTGGGTTTGAGG - Intergenic
997512592 5:134463769-134463791 CCCAAACTTGCCTGTCCTTGGGG + Intergenic
998043766 5:138970199-138970221 TCCCAGCCTGCCTTTGTTGGTGG - Intronic
998599033 5:143565982-143566004 CCCATGCCTGCCTGTGATCATGG + Intergenic
999152301 5:149434240-149434262 CGCATGCCTACCTGTGCTTGAGG + Intergenic
1000018748 5:157301021-157301043 GCCAAGCCTCACTATGTTTGGGG - Intronic
1005346552 6:24896172-24896194 ATCCAGCCTGCCTGGGTTTGCGG + Intronic
1006977256 6:38114701-38114723 TCCTAGCCTCCCTGTGTGTGAGG - Intronic
1007301193 6:40869152-40869174 GCTCAGCCTGCCTGTATTTGGGG + Intergenic
1010623560 6:78107017-78107039 ACCAAACCTGCCTATGTTTTGGG + Intergenic
1014418728 6:121215109-121215131 CCCAAGTCTGGCTGAGTCTGGGG + Intronic
1017526940 6:155249384-155249406 CCCAAGCCTGACTGGGCTTAGGG - Intronic
1018601243 6:165544459-165544481 TCAAAGCCTGTTTGTGTTTGGGG - Intronic
1019584991 7:1795722-1795744 CCCCAACATGCATGTGTTTGGGG - Intergenic
1022414363 7:30165326-30165348 CCCAAGGCTGCCTGTCGTTTTGG - Intergenic
1022574741 7:31486645-31486667 CCCAAAGCAGCCTGAGTTTGTGG - Intergenic
1022705323 7:32796634-32796656 CCCACACCTGCCTGTGGTTCAGG + Intergenic
1022923981 7:35042195-35042217 CCCAAATCTTCCTGTGTCTGGGG - Intergenic
1024035691 7:45505977-45505999 CCCATGCCTCCATGTGGTTGGGG - Intergenic
1024094088 7:45970575-45970597 GCCAGGCCTGCTTCTGTTTGGGG + Intergenic
1024548584 7:50541942-50541964 CCCAAGTCTGCCAGGGCTTGGGG + Intronic
1026326765 7:69317309-69317331 CCCAAACCAGCCAGTATTTGAGG - Intergenic
1026898804 7:74026077-74026099 CCCAAGCCACCCTTTGTTGGTGG - Intergenic
1029822296 7:103157968-103157990 CCCAAATCTTCCTGTGTCTGGGG - Intergenic
1030225258 7:107143448-107143470 TGCAAGCCTGCCATTGTTTGTGG + Intronic
1031385266 7:121142093-121142115 CCCAAGTCTGCCCTTGTTTGAGG + Exonic
1032591173 7:133193769-133193791 CCCAAGTCTGGCTGAGTCTGGGG + Intergenic
1035353475 7:158263493-158263515 CCCCATGCTGCCTGGGTTTGGGG + Intronic
1035399138 7:158553402-158553424 CCCAAGCCTGTGTGTGTATAAGG - Intronic
1036157824 8:6358801-6358823 ACCAAGACTGCCTGAGTTAGTGG + Intergenic
1036183818 8:6607371-6607393 CCCAAGTTTGCCTGTTTCTGTGG + Intronic
1036463386 8:8974064-8974086 CCCAAAACTGCATCTGTTTGGGG - Intergenic
1036915425 8:12799604-12799626 CCCAAGTCTGGCTGAGTCTGGGG + Intergenic
1038686858 8:29726933-29726955 CACAGGCATGCCTGTGTCTGTGG + Intergenic
1040984286 8:53277021-53277043 CCCAAGTCTGTATTTGTTTGGGG + Intergenic
1041289595 8:56296326-56296348 CCCATGCCTGCCTCTGTCTCTGG - Intergenic
1044068087 8:87723061-87723083 TCCAACCCTGCCTGGGGTTGTGG + Intergenic
1045046451 8:98283707-98283729 CCCACACCTGCCTGGGTTTCCGG + Intronic
1046115477 8:109778720-109778742 CCCAACACTGCCTCTGCTTGGGG - Intergenic
1046195730 8:110860644-110860666 CCCAAGTCTGGCTGAGTCTGGGG - Intergenic
1046457299 8:114483770-114483792 CCCAAGCCCGGCTGTGGATGAGG + Intergenic
1046586644 8:116156117-116156139 TGAAAGCCTGACTGTGTTTGAGG + Intergenic
1047846648 8:128813607-128813629 CCCTACTGTGCCTGTGTTTGGGG + Intergenic
1048811141 8:138287596-138287618 TCCTAGCCTGCCACTGTTTGGGG - Intronic
1049435979 8:142586473-142586495 CCCACGCCTGGCTGTGGTGGGGG - Intergenic
1049729367 8:144167967-144167989 CTCATGCCTGCCTGTGTGGGAGG + Intronic
1050363583 9:4853971-4853993 GCCAAGCCTGCCTCTACTTGGGG + Intronic
1051490379 9:17657447-17657469 CATCAGCCTGCCTCTGTTTGTGG - Intronic
1053553551 9:39109563-39109585 CCCAGCCATGCCTGTGTCTGTGG - Intronic
1053817663 9:41929710-41929732 CCCAGCCATGCCTGTGTCTGTGG - Intronic
1054107917 9:61073382-61073404 CCCAGCCATGCCTGTGTCTGTGG - Intergenic
1054612940 9:67257743-67257765 CCCAGCCATGCCTGTGTCTGTGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058427230 9:104885472-104885494 CCCAAGCCTGTGTGTTTTTCAGG - Intronic
1059392217 9:114006378-114006400 ACCAAGCCTCCCTGTGCCTGGGG + Intronic
1060345853 9:122815052-122815074 CTCAATTCTGCCTGTGTTTCAGG - Intronic
1060385300 9:123221120-123221142 CTCGGGCCTGCCTGTGTTTCAGG + Intronic
1061543492 9:131290588-131290610 CCGGAGCCTGCCTGTTTCTGGGG - Intronic
1062184611 9:135211374-135211396 TCCAAGCCTCCCTGTGTTCTTGG + Intergenic
1062464418 9:136674861-136674883 CCCCAGGCTGCATGTGGTTGGGG + Intronic
1062608042 9:137357063-137357085 GCCAAGCCTGCCTGTGCTAAGGG - Intronic
1185506145 X:633253-633275 GCAAAGCCTGCGGGTGTTTGAGG + Intronic
1185544053 X:927247-927269 CCCAAGCCTCACTCTGTTTTGGG + Intergenic
1186349225 X:8726651-8726673 CCCAAGCCTGCCCATGCTTAGGG + Intronic
1186902182 X:14068486-14068508 CCCAGGCCTTCCTGGGTTTGTGG + Intergenic
1188491924 X:30747021-30747043 TCCACGCGTGCATGTGTTTGGGG + Intergenic
1189093189 X:38109446-38109468 CACAAGCCTGCATGTGTCAGTGG + Intronic
1189324007 X:40102312-40102334 CCCACACGTGCCTGTGTTCGGGG - Intronic
1189856501 X:45229620-45229642 CCCAGGCCTCCCTGTGCTTTTGG - Intergenic
1192866403 X:75137569-75137591 CACATGCCTGCATATGTTTGTGG + Intronic
1199391997 X:147290903-147290925 CCCAAGACTGCCAATGTGTGAGG + Intergenic