ID: 932793462

View in Genome Browser
Species Human (GRCh38)
Location 2:74675169-74675191
Sequence GTGCCGGAGCTTCATGTTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932793462_932793470 26 Left 932793462 2:74675169-74675191 CCAACAACATGAAGCTCCGGCAC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 932793470 2:74675218-74675240 CCGCGTACTCACCTTCATCCGGG 0: 1
1: 0
2: 1
3: 1
4: 53
932793462_932793468 25 Left 932793462 2:74675169-74675191 CCAACAACATGAAGCTCCGGCAC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 932793468 2:74675217-74675239 ACCGCGTACTCACCTTCATCCGG 0: 1
1: 0
2: 0
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932793462 Original CRISPR GTGCCGGAGCTTCATGTTGT TGG (reversed) Exonic