ID: 932793468

View in Genome Browser
Species Human (GRCh38)
Location 2:74675217-74675239
Sequence ACCGCGTACTCACCTTCATC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 23}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932793462_932793468 25 Left 932793462 2:74675169-74675191 CCAACAACATGAAGCTCCGGCAC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 932793468 2:74675217-74675239 ACCGCGTACTCACCTTCATCCGG 0: 1
1: 0
2: 0
3: 2
4: 23
932793464_932793468 9 Left 932793464 2:74675185-74675207 CCGGCACTTTGGCTCATCTCTCT 0: 1
1: 0
2: 0
3: 19
4: 298
Right 932793468 2:74675217-74675239 ACCGCGTACTCACCTTCATCCGG 0: 1
1: 0
2: 0
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932793468 Original CRISPR ACCGCGTACTCACCTTCATC CGG Exonic