ID: 932793468

View in Genome Browser
Species Human (GRCh38)
Location 2:74675217-74675239
Sequence ACCGCGTACTCACCTTCATC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 23}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932793462_932793468 25 Left 932793462 2:74675169-74675191 CCAACAACATGAAGCTCCGGCAC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 932793468 2:74675217-74675239 ACCGCGTACTCACCTTCATCCGG 0: 1
1: 0
2: 0
3: 2
4: 23
932793464_932793468 9 Left 932793464 2:74675185-74675207 CCGGCACTTTGGCTCATCTCTCT 0: 1
1: 0
2: 0
3: 19
4: 298
Right 932793468 2:74675217-74675239 ACCGCGTACTCACCTTCATCCGG 0: 1
1: 0
2: 0
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932793468 Original CRISPR ACCGCGTACTCACCTTCATC CGG Exonic
900251284 1:1671450-1671472 ACCCGGTGCTCACCTGCATCTGG - Intronic
1088853968 11:113729649-113729671 ACAGCTTACTCACCTTCTTAAGG + Intergenic
1094147353 12:27244323-27244345 TCCGCGAACTCACCTGCCTCCGG - Exonic
1101542735 12:105679985-105680007 TCAGTGTCCTCACCTTCATCAGG - Intergenic
1106839283 13:33669462-33669484 ACCGCTTGCTCACCTCCATCTGG + Intergenic
1131746902 15:95458515-95458537 ACAGCGTTCTCACCACCATCAGG + Intergenic
1140058614 16:71547648-71547670 ACCACATACACACCTTCCTCTGG + Intronic
1154322957 18:13369190-13369212 ACCACTTACTCACCTTCTTAGGG + Intronic
1157349831 18:46874483-46874505 CCCTGGCACTCACCTTCATCAGG + Intronic
1158905879 18:62011215-62011237 ACCACCTACTCACCTCCATCTGG - Intergenic
932793468 2:74675217-74675239 ACCGCGTACTCACCTTCATCCGG + Exonic
942694170 2:178620403-178620425 ACAATGTATTCACCTTCATCTGG + Exonic
1174914802 20:54643460-54643482 CCCGCTCACTCATCTTCATCTGG - Exonic
970001842 4:11372611-11372633 AGCGCCTTCTCAGCTTCATCTGG - Intergenic
1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG + Intergenic
1022927604 7:35071763-35071785 CCCTCCTACTCACCTTCTTCAGG + Intergenic
1028374662 7:90133825-90133847 CCCTCCTACTCACCTTCTTCAGG - Intergenic
1038416277 8:27398358-27398380 TCCAGGTACCCACCTTCATCAGG + Intronic
1041713449 8:60913349-60913371 ACCCTGTTCTCACCTGCATCTGG - Intergenic
1047229420 8:122983611-122983633 ACCCCGTATTCACCTTTATTTGG - Intergenic
1048256660 8:132910119-132910141 TCCACGTTCTCACCTTCACCAGG + Intronic
1194491470 X:94555280-94555302 TCAGTGTACTCAGCTTCATCAGG - Intergenic
1195779190 X:108441451-108441473 ACCGGGTACACACCTTCAGAAGG - Intronic
1195810013 X:108818503-108818525 TCAGTGTACCCACCTTCATCAGG + Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic