ID: 932795756

View in Genome Browser
Species Human (GRCh38)
Location 2:74694402-74694424
Sequence TGAACTCTTTTTACAAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932795752_932795756 -5 Left 932795752 2:74694384-74694406 CCACACCAAGAGCCCTTTTGAAC No data
Right 932795756 2:74694402-74694424 TGAACTCTTTTTACAAAATGAGG No data
932795753_932795756 -10 Left 932795753 2:74694389-74694411 CCAAGAGCCCTTTTGAACTCTTT No data
Right 932795756 2:74694402-74694424 TGAACTCTTTTTACAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932795756 Original CRISPR TGAACTCTTTTTACAAAATG AGG Intergenic
No off target data available for this crispr