ID: 932801158

View in Genome Browser
Species Human (GRCh38)
Location 2:74743577-74743599
Sequence CATCCATGTCCTGCCAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932801158_932801165 28 Left 932801158 2:74743577-74743599 CCCCACCTGGCAGGACATGGATG No data
Right 932801165 2:74743628-74743650 TGTGCAACTCTCCTCTTTGGTGG No data
932801158_932801164 25 Left 932801158 2:74743577-74743599 CCCCACCTGGCAGGACATGGATG No data
Right 932801164 2:74743625-74743647 CTGTGTGCAACTCTCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932801158 Original CRISPR CATCCATGTCCTGCCAGGTG GGG (reversed) Intergenic