ID: 932801158 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:74743577-74743599 |
| Sequence | CATCCATGTCCTGCCAGGTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 932801158_932801164 | 25 | Left | 932801158 | 2:74743577-74743599 | CCCCACCTGGCAGGACATGGATG | No data | ||
| Right | 932801164 | 2:74743625-74743647 | CTGTGTGCAACTCTCCTCTTTGG | No data | ||||
| 932801158_932801165 | 28 | Left | 932801158 | 2:74743577-74743599 | CCCCACCTGGCAGGACATGGATG | No data | ||
| Right | 932801165 | 2:74743628-74743650 | TGTGCAACTCTCCTCTTTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 932801158 | Original CRISPR | CATCCATGTCCTGCCAGGTG GGG (reversed) | Intergenic | ||