ID: 932801160

View in Genome Browser
Species Human (GRCh38)
Location 2:74743579-74743601
Sequence CACATCCATGTCCTGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932801160_932801164 23 Left 932801160 2:74743579-74743601 CCACCTGGCAGGACATGGATGTG No data
Right 932801164 2:74743625-74743647 CTGTGTGCAACTCTCCTCTTTGG No data
932801160_932801165 26 Left 932801160 2:74743579-74743601 CCACCTGGCAGGACATGGATGTG No data
Right 932801165 2:74743628-74743650 TGTGCAACTCTCCTCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932801160 Original CRISPR CACATCCATGTCCTGCCAGG TGG (reversed) Intergenic