ID: 932801161

View in Genome Browser
Species Human (GRCh38)
Location 2:74743582-74743604
Sequence ACGCACATCCATGTCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932801161_932801165 23 Left 932801161 2:74743582-74743604 CCTGGCAGGACATGGATGTGCGT No data
Right 932801165 2:74743628-74743650 TGTGCAACTCTCCTCTTTGGTGG No data
932801161_932801166 30 Left 932801161 2:74743582-74743604 CCTGGCAGGACATGGATGTGCGT No data
Right 932801166 2:74743635-74743657 CTCTCCTCTTTGGTGGATTCAGG No data
932801161_932801164 20 Left 932801161 2:74743582-74743604 CCTGGCAGGACATGGATGTGCGT No data
Right 932801164 2:74743625-74743647 CTGTGTGCAACTCTCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932801161 Original CRISPR ACGCACATCCATGTCCTGCC AGG (reversed) Intergenic