ID: 932801163

View in Genome Browser
Species Human (GRCh38)
Location 2:74743610-74743632
Sequence GCACACAGAGAGACATACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932801163_932801164 -8 Left 932801163 2:74743610-74743632 CCTGTGTATGTCTCTCTGTGTGC No data
Right 932801164 2:74743625-74743647 CTGTGTGCAACTCTCCTCTTTGG No data
932801163_932801166 2 Left 932801163 2:74743610-74743632 CCTGTGTATGTCTCTCTGTGTGC No data
Right 932801166 2:74743635-74743657 CTCTCCTCTTTGGTGGATTCAGG No data
932801163_932801165 -5 Left 932801163 2:74743610-74743632 CCTGTGTATGTCTCTCTGTGTGC No data
Right 932801165 2:74743628-74743650 TGTGCAACTCTCCTCTTTGGTGG No data
932801163_932801167 3 Left 932801163 2:74743610-74743632 CCTGTGTATGTCTCTCTGTGTGC No data
Right 932801167 2:74743636-74743658 TCTCCTCTTTGGTGGATTCAGGG No data
932801163_932801169 24 Left 932801163 2:74743610-74743632 CCTGTGTATGTCTCTCTGTGTGC No data
Right 932801169 2:74743657-74743679 GGTCCTTGTGTCATTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932801163 Original CRISPR GCACACAGAGAGACATACAC AGG (reversed) Intergenic