ID: 932801165

View in Genome Browser
Species Human (GRCh38)
Location 2:74743628-74743650
Sequence TGTGCAACTCTCCTCTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932801161_932801165 23 Left 932801161 2:74743582-74743604 CCTGGCAGGACATGGATGTGCGT No data
Right 932801165 2:74743628-74743650 TGTGCAACTCTCCTCTTTGGTGG No data
932801159_932801165 27 Left 932801159 2:74743578-74743600 CCCACCTGGCAGGACATGGATGT No data
Right 932801165 2:74743628-74743650 TGTGCAACTCTCCTCTTTGGTGG No data
932801160_932801165 26 Left 932801160 2:74743579-74743601 CCACCTGGCAGGACATGGATGTG No data
Right 932801165 2:74743628-74743650 TGTGCAACTCTCCTCTTTGGTGG No data
932801158_932801165 28 Left 932801158 2:74743577-74743599 CCCCACCTGGCAGGACATGGATG No data
Right 932801165 2:74743628-74743650 TGTGCAACTCTCCTCTTTGGTGG No data
932801163_932801165 -5 Left 932801163 2:74743610-74743632 CCTGTGTATGTCTCTCTGTGTGC No data
Right 932801165 2:74743628-74743650 TGTGCAACTCTCCTCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932801165 Original CRISPR TGTGCAACTCTCCTCTTTGG TGG Intergenic