ID: 932801166

View in Genome Browser
Species Human (GRCh38)
Location 2:74743635-74743657
Sequence CTCTCCTCTTTGGTGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932801163_932801166 2 Left 932801163 2:74743610-74743632 CCTGTGTATGTCTCTCTGTGTGC No data
Right 932801166 2:74743635-74743657 CTCTCCTCTTTGGTGGATTCAGG No data
932801161_932801166 30 Left 932801161 2:74743582-74743604 CCTGGCAGGACATGGATGTGCGT No data
Right 932801166 2:74743635-74743657 CTCTCCTCTTTGGTGGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932801166 Original CRISPR CTCTCCTCTTTGGTGGATTC AGG Intergenic