ID: 932801167

View in Genome Browser
Species Human (GRCh38)
Location 2:74743636-74743658
Sequence TCTCCTCTTTGGTGGATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932801163_932801167 3 Left 932801163 2:74743610-74743632 CCTGTGTATGTCTCTCTGTGTGC No data
Right 932801167 2:74743636-74743658 TCTCCTCTTTGGTGGATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932801167 Original CRISPR TCTCCTCTTTGGTGGATTCA GGG Intergenic