ID: 932801168

View in Genome Browser
Species Human (GRCh38)
Location 2:74743639-74743661
Sequence GGACCCTGAATCCACCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932801168_932801171 23 Left 932801168 2:74743639-74743661 CCTCTTTGGTGGATTCAGGGTCC No data
Right 932801171 2:74743685-74743707 GTCAAGAAGCATCCTTAGACTGG No data
932801168_932801169 -5 Left 932801168 2:74743639-74743661 CCTCTTTGGTGGATTCAGGGTCC No data
Right 932801169 2:74743657-74743679 GGTCCTTGTGTCATTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932801168 Original CRISPR GGACCCTGAATCCACCAAAG AGG (reversed) Intergenic