ID: 932801169

View in Genome Browser
Species Human (GRCh38)
Location 2:74743657-74743679
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932801163_932801169 24 Left 932801163 2:74743610-74743632 CCTGTGTATGTCTCTCTGTGTGC No data
Right 932801169 2:74743657-74743679 GGTCCTTGTGTCATTTTTCAAGG No data
932801168_932801169 -5 Left 932801168 2:74743639-74743661 CCTCTTTGGTGGATTCAGGGTCC No data
Right 932801169 2:74743657-74743679 GGTCCTTGTGTCATTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type