ID: 932805297

View in Genome Browser
Species Human (GRCh38)
Location 2:74778041-74778063
Sequence TATGTGTTTAAAGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932805294_932805297 3 Left 932805294 2:74778015-74778037 CCCTCAAGGGAAGGAGACACTGA No data
Right 932805297 2:74778041-74778063 TATGTGTTTAAAGATGCTGCAGG No data
932805290_932805297 19 Left 932805290 2:74777999-74778021 CCAATGGTGATAGCTACCCTCAA No data
Right 932805297 2:74778041-74778063 TATGTGTTTAAAGATGCTGCAGG No data
932805295_932805297 2 Left 932805295 2:74778016-74778038 CCTCAAGGGAAGGAGACACTGAG No data
Right 932805297 2:74778041-74778063 TATGTGTTTAAAGATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932805297 Original CRISPR TATGTGTTTAAAGATGCTGC AGG Intergenic
No off target data available for this crispr