ID: 932806937

View in Genome Browser
Species Human (GRCh38)
Location 2:74792417-74792439
Sequence CCAGGAAGGCAGGGCCTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932806923_932806937 16 Left 932806923 2:74792378-74792400 CCCCGACTTTCTGAGAGTGAGGG No data
Right 932806937 2:74792417-74792439 CCAGGAAGGCAGGGCCTAGTAGG No data
932806925_932806937 15 Left 932806925 2:74792379-74792401 CCCGACTTTCTGAGAGTGAGGGG No data
Right 932806937 2:74792417-74792439 CCAGGAAGGCAGGGCCTAGTAGG No data
932806927_932806937 14 Left 932806927 2:74792380-74792402 CCGACTTTCTGAGAGTGAGGGGG No data
Right 932806937 2:74792417-74792439 CCAGGAAGGCAGGGCCTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932806937 Original CRISPR CCAGGAAGGCAGGGCCTAGT AGG Intergenic
No off target data available for this crispr