ID: 932808258

View in Genome Browser
Species Human (GRCh38)
Location 2:74801360-74801382
Sequence GGATACACAAAGAGACAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932808253_932808258 20 Left 932808253 2:74801317-74801339 CCTAAAACACTCTGACTAATATC No data
Right 932808258 2:74801360-74801382 GGATACACAAAGAGACAGCAGGG No data
932808255_932808258 -2 Left 932808255 2:74801339-74801361 CCTTATAAGAAGAGGAAATTTGG 0: 66
1: 223
2: 613
3: 1127
4: 1602
Right 932808258 2:74801360-74801382 GGATACACAAAGAGACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932808258 Original CRISPR GGATACACAAAGAGACAGCA GGG Intergenic
No off target data available for this crispr