ID: 932808258 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:74801360-74801382 |
Sequence | GGATACACAAAGAGACAGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
932808253_932808258 | 20 | Left | 932808253 | 2:74801317-74801339 | CCTAAAACACTCTGACTAATATC | No data | ||
Right | 932808258 | 2:74801360-74801382 | GGATACACAAAGAGACAGCAGGG | No data | ||||
932808255_932808258 | -2 | Left | 932808255 | 2:74801339-74801361 | CCTTATAAGAAGAGGAAATTTGG | 0: 66 1: 223 2: 613 3: 1127 4: 1602 |
||
Right | 932808258 | 2:74801360-74801382 | GGATACACAAAGAGACAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
932808258 | Original CRISPR | GGATACACAAAGAGACAGCA GGG | Intergenic | ||
No off target data available for this crispr |