ID: 932812046

View in Genome Browser
Species Human (GRCh38)
Location 2:74834009-74834031
Sequence ATTGGCTGCGCCACGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932812040_932812046 -4 Left 932812040 2:74833990-74834012 CCGCGAGCCGTGAGCGATGATTG 0: 1
1: 0
2: 0
3: 4
4: 16
Right 932812046 2:74834009-74834031 ATTGGCTGCGCCACGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 70
932812039_932812046 -3 Left 932812039 2:74833989-74834011 CCCGCGAGCCGTGAGCGATGATT 0: 1
1: 0
2: 1
3: 0
4: 87
Right 932812046 2:74834009-74834031 ATTGGCTGCGCCACGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 70
932812037_932812046 17 Left 932812037 2:74833969-74833991 CCGGTGTCTGAGCGGCCGCGCCC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 932812046 2:74834009-74834031 ATTGGCTGCGCCACGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 70
932812038_932812046 2 Left 932812038 2:74833984-74834006 CCGCGCCCGCGAGCCGTGAGCGA 0: 1
1: 0
2: 0
3: 7
4: 28
Right 932812046 2:74834009-74834031 ATTGGCTGCGCCACGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 70
932812036_932812046 23 Left 932812036 2:74833963-74833985 CCGGCTCCGGTGTCTGAGCGGCC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 932812046 2:74834009-74834031 ATTGGCTGCGCCACGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932812046 Original CRISPR ATTGGCTGCGCCACGGCGGC GGG Exonic
905948054 1:41920210-41920232 ATTGGCTGGGCCCTGGCAGCCGG + Intronic
913592297 1:120341316-120341338 ATGGGCTGAGCGGCGGCGGCCGG - Intergenic
913651061 1:120913829-120913851 ATGGGCTGAGCGGCGGCGGCCGG + Intergenic
914170052 1:145215238-145215260 ATGGGCTGAGCGGCGGCGGCCGG - Intergenic
914525171 1:148459201-148459223 ATGGGCTGAGCGGCGGCGGCCGG - Intergenic
914641233 1:149607933-149607955 ATGGGCTGAGCGGCGGCGGCCGG + Intergenic
1076161199 10:128245508-128245530 TTTGGCTGCACCATGGGGGCAGG - Intergenic
1084539168 11:69775680-69775702 TAGGGCTGCGCCAAGGCGGCCGG - Intergenic
1086408917 11:86524296-86524318 ATTGGCTGCGCCTCTGAGTCAGG - Intronic
1086888241 11:92226776-92226798 ATTGGGCGCGCGGCGGCGGCGGG - Intergenic
1087248378 11:95867987-95868009 ATAGGCTGAGCCACTGCGCCTGG - Intronic
1089567115 11:119377725-119377747 GTTGGCTGCCCCACGGGGACAGG - Intronic
1100234860 12:92650817-92650839 AGTGGCTGAGGCACGGCTGCTGG + Intergenic
1103563109 12:121803017-121803039 ATTGGCTGGAGCAGGGCGGCAGG - Intronic
1107495115 13:40918678-40918700 ATTAGCTGGGCCATGGTGGCAGG - Intergenic
1114483291 14:23048209-23048231 AGGAGCTGCGCCACGTCGGCGGG + Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1126990974 15:54374778-54374800 CCTGGCTGCGCCTCGCCGGCTGG + Intronic
1127207179 15:56733287-56733309 ACCGGCTGCGCGGCGGCGGCCGG - Intronic
1128398644 15:67254675-67254697 TTGGGCTGCACCACGGCCGCCGG + Exonic
1128529145 15:68432065-68432087 ATGGCCCGCGGCACGGCGGCTGG + Exonic
1132466126 16:78136-78158 ACTGGCTGCGCCCCCGGGGCGGG - Intronic
1132896469 16:2231712-2231734 ATGGGCTGGGCCACTGCAGCAGG - Intronic
1134700261 16:16259036-16259058 AGTGGCTGGGCCCAGGCGGCTGG + Intronic
1138420371 16:56895087-56895109 ATGGGCTGGGCCAAGGCAGCTGG + Intronic
1143602188 17:7954969-7954991 ATAGGCTGAGCCACTGCGCCTGG - Intergenic
1144787500 17:17840190-17840212 ATTGGCTGCGCCGGGCCCGCGGG - Intergenic
1144870045 17:18363622-18363644 ATTGGCTGCGGCGCAGCGGCGGG + Intergenic
1147808139 17:43147141-43147163 ACAGGCTGCGCCACCGCGCCCGG + Intergenic
1150915750 17:69435258-69435280 ACAGGCTGAGCCACGGCGCCTGG - Intronic
1154218238 18:12431421-12431443 AGGGGCTGGGCCACTGCGGCAGG - Exonic
1155385778 18:25275766-25275788 ATTGCCTACGCCACGGAGACAGG + Intronic
1161623388 19:5311284-5311306 ATAGGCTGAGCCACTGCGCCCGG + Intronic
1161686826 19:5707032-5707054 AGTGGCTGCGCCTCAGCCGCGGG + Intronic
1166365156 19:42274409-42274431 ATCGGCTGGGCCACGGCAGTTGG - Intronic
1166546898 19:43639518-43639540 GGGGGCTGCGGCACGGCGGCCGG + Intronic
1168706293 19:58472122-58472144 GCTGGCTGCGAGACGGCGGCTGG - Exonic
926207893 2:10847033-10847055 TTTGGCTGGGCCAAGGGGGCTGG - Intergenic
929599310 2:43194969-43194991 ATTGGCTGCTGCACGGCTGCAGG + Intergenic
932812046 2:74834009-74834031 ATTGGCTGCGCCACGGCGGCGGG + Exonic
938078730 2:128357734-128357756 ATTCACTGGGCCTCGGCGGCTGG - Intergenic
941295695 2:163736333-163736355 AATGGCCGCGCCGCGCCGGCCGG + Intergenic
947829756 2:233130651-233130673 AATGGCTGGCCCACGGGGGCGGG + Intronic
1176425638 21:6546741-6546763 CTTGGCTGGGCCACGGCGCCCGG + Intergenic
1179701129 21:43155058-43155080 CTTGGCTGGGCCACGGCGCCCGG + Intergenic
1182147103 22:28003282-28003304 ATCAGCTGTGCCACTGCGGCTGG - Intronic
1183599126 22:38829888-38829910 ATTGGCTGGGCCAGTGAGGCTGG - Intronic
1183780252 22:39994887-39994909 ATTGGCCGCTCCCCGACGGCGGG + Intergenic
950526681 3:13528552-13528574 ATTTGCAGCTCCAGGGCGGCCGG - Intergenic
954686510 3:52373012-52373034 AGTGGATGGACCACGGCGGCTGG + Exonic
964720684 3:159764956-159764978 AGTGGCCGCGGCCCGGCGGCTGG + Exonic
966696278 3:182793513-182793535 GGTGGCTGCGGCGCGGCGGCAGG + Exonic
969785686 4:9455417-9455439 AGTAGCTGCGCCACAGCTGCTGG + Intergenic
969789112 4:9479827-9479849 AGTAGCTGCGCCACAGCTGCTGG + Intergenic
976789867 4:88866193-88866215 ATTAGCTGGGCCATGGTGGCAGG - Intronic
982273067 4:153611156-153611178 ATTGGCTGCTCCACAGGGGCAGG + Intronic
985911804 5:2890149-2890171 AATCGCGGCTCCACGGCGGCTGG + Intergenic
987193367 5:15500800-15500822 ATGGGGTGCGTCACGGCCGCGGG - Intronic
989983315 5:50667549-50667571 ATGGGCTGAGCGGCGGCGGCCGG + Intronic
1006861438 6:37174067-37174089 ATTTGCTGGGCCCCGGCGACAGG - Exonic
1018442727 6:163828144-163828166 CTTGGCAGGTCCACGGCGGCAGG - Intergenic
1020418226 7:7969495-7969517 GTGGGCTGCGCCCCGGCTGCGGG + Exonic
1024995817 7:55272505-55272527 ATGGGCTGGGCCACTGGGGCAGG + Intergenic
1025295418 7:57772319-57772341 AATGGCAGCTGCACGGCGGCAGG - Intergenic
1027211218 7:76150355-76150377 ACTGGCGCAGCCACGGCGGCGGG - Intergenic
1032011772 7:128351914-128351936 AGGGGCTGCGCCCCTGCGGCAGG + Exonic
1034244963 7:149637014-149637036 AGTGGCTGAGCCACGGCCCCAGG + Intergenic
1037950768 8:23017608-23017630 TCTGGCTGAGCCACGGTGGCTGG - Exonic
1040059773 8:43093933-43093955 ATAGGCGGCGCCACCGCGCCCGG - Intronic
1049519593 8:143081105-143081127 GCTGGCTGCGCCACGACGCCAGG + Exonic
1056711043 9:88991800-88991822 CTTGGGCGCGCCACGGCGGCCGG + Intronic
1056934283 9:90903885-90903907 ACTGGCTGTGCCACAGCAGCAGG - Intergenic
1057686735 9:97241448-97241470 ATTAGCTGGGCCATGGTGGCAGG + Intergenic
1059326587 9:113507496-113507518 ATGGGCTGCTGCTCGGCGGCTGG + Exonic
1061520833 9:131116950-131116972 ATTGGCTGCGCCACGGCCCATGG + Intronic
1061975928 9:134068053-134068075 ATGCGCTGCGCCGCGGCGCCTGG + Intronic
1062103595 9:134740788-134740810 CTTGGCTCCTCCACGGCAGCTGG - Intronic
1062467378 9:136687193-136687215 GCCTGCTGCGCCACGGCGGCCGG - Exonic