ID: 932813281

View in Genome Browser
Species Human (GRCh38)
Location 2:74841991-74842013
Sequence AAAGCCAGAGTTCAACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932813281_932813285 26 Left 932813281 2:74841991-74842013 CCCTGGGGTTGAACTCTGGCTTT 0: 1
1: 0
2: 2
3: 35
4: 237
Right 932813285 2:74842040-74842062 GTCAGTTACTCTACCTGTCTAGG 0: 1
1: 0
2: 1
3: 33
4: 518
932813281_932813284 4 Left 932813281 2:74841991-74842013 CCCTGGGGTTGAACTCTGGCTTT 0: 1
1: 0
2: 2
3: 35
4: 237
Right 932813284 2:74842018-74842040 ATAACACGCAGTGTGAGCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 121
932813281_932813283 3 Left 932813281 2:74841991-74842013 CCCTGGGGTTGAACTCTGGCTTT 0: 1
1: 0
2: 2
3: 35
4: 237
Right 932813283 2:74842017-74842039 CATAACACGCAGTGTGAGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932813281 Original CRISPR AAAGCCAGAGTTCAACCCCA GGG (reversed) Intronic