ID: 932813356

View in Genome Browser
Species Human (GRCh38)
Location 2:74842790-74842812
Sequence GCATCCCAGAGACCTCGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932813356_932813362 26 Left 932813356 2:74842790-74842812 CCCATTCGAGGTCTCTGGGATGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 932813362 2:74842839-74842861 AAGCATCCTTGCGATGTCGCAGG 0: 1
1: 0
2: 0
3: 0
4: 33
932813356_932813361 0 Left 932813356 2:74842790-74842812 CCCATTCGAGGTCTCTGGGATGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 932813361 2:74842813-74842835 CTGGGACATTAGTGCACTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932813356 Original CRISPR GCATCCCAGAGACCTCGAAT GGG (reversed) Intronic